Bonanas for Bonanza - Re-Release: Bonanas For Bonanza Episode #9: “Mr. Henry Comstock”
Episode Date: June 7, 2023Subscribe to The Andy Daly Podcast Project at Patreon.com/AndyDalyThe "Scam Goddess" herself, comedian Laci Mosley joins the program to talk about which tragedies she would add to Amy's tragedy charm ...bracelets, and what went wrong at the Wilcox Ranch Exposition for Cowboy Poetry. Then they discuss season 1, episode 9 of Bonanza, "Mr. Henry Comstock," in which we meet the original scam artist who inspired the name of Virginia City.Merch: redbubble.com/people/ADPodProject/shopMail: PO Box 9407 Glendale, CA 91226Email: bonanaspod@gmail.comAndy’s website: andydaly.comRelease date: July 20, 2020 Hosted on Acast. See acast.com/privacy for more information.
Transcript
Discussion (0)
You're about to listen to Bananas for Bananza episode 9.
This is Andy Daly.
Hello!
Here on this free feed, I'll be re-releasing all of the back episodes of Bananas for Bananza
one every other week.
If you want to hear new episodes, add free, please subscribe to my Patreon at Patrion
dot com slash Andy Daily. The entire Bananas for Bananza Archive is also waiting for you there and you can access lots and lots of bonus content.
So do that. Okay, thank you. Enjoy.
Yeah. It's a finest show alive, so consult your TV guide, get your great outdoors inside,
take some ponderosa pride and forever made.
RID!
I'm Banas for Bananza.
All right, Brian, here we go.
Here comes a big ye, huh.
I'm gonna for bonanza.
All right, Brian.
Here we go.
Here comes a big yeha.
I'm gonna make it the biggest one yet.
Here we go.
Ready?
Heahah!
Ha!
Damn!
Damn!
Whoa, Mudaylor, what was that?
That was an exploding rambo arrow.
Man! Yeah, last time you had a rambo arrow, but it wasn't rigged up to explode and this
time it damn well exploded.
What did you blow up, my friend?
Oh, it looks like my neighbor's truck.
Oh, really?
Yeah, and I do apologize to him via this podcast.
He better to apologize.
You know what, I won't even go over apologize.
. listening. I'll you know what I won't even go over apologize I'll say listen to episode seven of Bananas for Bananza. That's a better idea see not only
is that a de facto apology but it promotes our podcast. That's not a bad
idea at all. Matter of fact, anybody who wants an apology for me anywhere in
the world I'll tell them listen to bananas for banza. They're not going to get one here it'll get to get one here. It'll get they'll get the the to get the the to get to get the the I I I I I I I I I I I I I I I I I I I I I got the the the the the the to get to get the the the the to get the the the the to get to get to get to get the the to get the the to get the the the the the the the the the the the the the the the the the the the the the the the the the the the the to get. to get. to get. to get. to get to get to get to get to get to get to get the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the to listen to it anyways. That's Mutt Taylor. Hey, you're listening. Wait a minute. Here me, let me say the thing I say at the top of the episodes.
Hello, friend, come on in.
The gate is open wide.
Welcome to episode nine and seven of Bananas for Bonanza
with Dalton Wilcox.
That's me.
I am Dalton Wilcox.
And we're also also also also also also also also also also also also also also also also also also also also also also also also also also also also also.
. We're also here with a regular co-host, Mutt Taylor, who you just heard from. Hello, Mut.
Hello.
And Amy Sleverson is here, Christian Entrepreneur, Amy Sleverson.
How's it going, Amy?
Well, it's Lots Daughters is going great.
And if anybody wants to get in and become a consultant, there's a lot's daughter's
starter kit that is now going to be available with
it's $99 and you start out with a charm bracelet that you add
memories of different traumas that you've had.
And we have all sorts of charms that you can add.
Well, we're definitely going to talk about that.
Last time we did one of these episodes we was talking about how you've got these,
I think, what we're calling it, a tragedy bracelet?
Tragedy charms.
It's a tragedy bracelet,
but it's really about remembering really bad things,
but then it kind of has a little jingle
on your arm.
It's a conversation starter. So all of your tragedies are memorialized in these little charms on your bracelet and it
jingles when you walk and it's a, yeah, I like it conversation started.
You could talk pretty much everywhere you go, somebody's going to ask you about all the
worst things that ever happened in your life.
Well, and that, that is what bringing my, I'm making,
I'm a profit, profiting and trying to bring
different things like teaspoons and popcorn boxes and bun pans
and kitchen caddies, into homes that were already Christlike,
but now can have Christlike clutter. Oh, beautiful. That should be, that, that's, that you put that right, that, and that, that's, that. And that, that, that, and that, that, that's that, that's that, that's that, that's that, that's that's that's that, that's that, that's that, that, that, that, that. that. that. Prof, that. Prof, that. Profit that. Prof that. Prof that. Profit that. Profit, that. Profit, that. Profing. Profing. Profing. Profing. Profing. Prof, that. Prof, that. Prof, that. Prof, that. Prof, that. Prof, that, that, that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that were already Christ-like but now can have Christ-like clutter.
Oh, beautiful.
Clearly, that's beautiful.
That should put that right there on your website.
Now you've got to have Christ-like clutter.
Dalton, we're going to dedicate a little bit of time to ask her about a charm each episode,
because that has been my reason for living, and I don't know if we want to do that now or not you're going to do it. I think not quite right now. We do, we have a guest I want to introduce, but before we even do that, I do
need to address the events of this past weekend where we had the 2020 first annual Wilcox
Ranch exposition of cowboy poetry, wit, wisdom, western music, beans, neckerchiefs, gonaria, painting my barn and rope tricks. And man, it was it it it it it was it was it was it was it was it was it was it was it was it was it was it was it was it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, it was, I. the their. their. their. their. the their. their. their. their, I. their, their, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the events. I. I. I. the events. the event, the event, the event, the event, the event, the the the the the the the the they. they. the the the they. the the th. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to a goddamn disaster. It was, it was, I had to press
the self-destruct button on the Wilcox branch. I just got out of the emergency room.
Damn, I can't believe how, I'm furious about it. Now I'm staying in a, you know, like any good
cowboy, I've got every inch of my ranch covered in explosives at any time when things go that horribly as they
did on Saturday, 4th of July.
Now first of all, I was expecting 200,000 people to come to this, and that's what happened,
but almost all of them was invisible man's.
It was just thousands upon thousands of invisible man's.
And, you know, at a certain point I got so mad at him, I started stabbing and shooting
indiscriminately just trying to shoot some invisible man's or stab them.
We had almost everything went wrong.
Russell Shine did show up, but I guess he saw the sign that said Dunk Rousshain in a dunk
tang full of piss and he ran away.
And it was funny to see him run, but, and Mano Agoppian didn't show up and Bartle B. Mokae he forgot about it.
Chip Junction's grandmother said he couldn't come and Cram Daniels at the last minute he said
no we're hosting a live edition of our Deadwood podcast on YouTube or something like that and
I guess two million people watched it but he didn't come down.
The only thing we did have, Amy,
you were there selling some Christian homes.
That's right, I came in on the 13th chapter of Revelations.
I addressed as a beast with 10 horns atop seven heads,
and I rose out of the piss, and I was the dragon, but then also a lamb.
And that was beautiful.
I mean, that was one of the highlights for me of the whole weekend. It. It. It. It. It's, th. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. I. I. I. I. I. I. I was. I was. I was. I was. I was. I was. I was, th. I was, thi. It was, th. I was, th. I was. I was. It was, th. It was, th. It was, th. It was, thi. It was, the. It was, the, the, the, the, the, the, the, the, the, the, the. It was, the. It was, the the the the the the the the the the the the the the the the the the thi. I was, thi. I was, thi. I was, the thi. I was, the the the theea. thi. to. thea. thea. thea. thea. thea. thea. the that was that was one of the highlights
for me of the whole weekend. Wonderful. And then you was there you brought
those mirrors to do that one man Mexican standoff. Yeah now I didn't I made good
on my word. I brought up two full-size body-length mirrors to do a one-man Mexican standoff.
But problem is sun come down around four o'clock gets real low on the horizon, shot a beam directly at
that mirror which then ricocheted off another mirror.
Both of them had a beam concentrated right in my side and it burned a hole through one of
my livers but here's a crazy thing.
So, it took straight through my torso.
It cotterized the wound. So I just have this tunnel, is all I can call it, is just in the side side side side side side side side side side side side side side side side side side side, I, I'm a the side, I, I'm, I'm, I'm, I, I'm, I'm, the the the the the the the the the thoicicic. thi, I, I, I, I, th. thi, it, thi, thi, thoom. thoom. thoom. th. th. tooom. tooom. tooom. th. to, th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. I, th. th. It, I, I, th. thin, thin, thin, t t t t t to, to, toooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooom. C. C. C. C. this tunnel, is all I can call it, is just in the side of my guttuck, right there in my guttucks,
and you could put an arm through it.
And I'd invite you to do that next time I see you,
but God knows when that'll be.
Anyway, I'm back and here I am, mother fucker.
Yeah, nobody ever would have expected that have a little hole in it so it's called a
ponderosa wife.
Wow I'd like one of them I think. That sounds real good. A cutting board with a
hole in it? Well you can hang it up or you can you can use it as a partner. Yeah. That's kind of what I am now with this hole in my side.
Look at that. Exactly. Probably all sorts of uses for that hole there. Much
you just need to be creative. Well I do want to apologize by the way that
as soon as the journeyman took the stages when I realized I had to hit
the self-destruct buctomotthink the sheriff deputized some vampires Because they didn't show up till the sun went down. That's awfully suspicious
And it was just a real mess
Yeah, we know better for next year because we next year we know better right. Yeah
Specifically say on the flyer no invisible man's all right all right. All right it now
Now let's introduce our wonderful guests. They assured me she was a huge Ban now and they keep saying that and it and it and it and it and it and it and it and it and it and it and it and it that and it that and it that and it th th th th th th th th th th th th th th th th th the the the to to to to to to to to to to the the the to their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their te. te. te's te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te's te's te. This is exciting. They assured me she was a huge Bonanza fan.
Now, and they keep saying that,
and it turns out to be a goddamn today.
But this time we've got the host of a podcast
called The Scam Goddess.
Her name is Lacey Mosley.
Hello, Lacey.
Hi, Lacey. I'm a big fan.
Oh, you're a fan. fan of the scam gotters. Yeah and I for one cannot wait to hear what Lacey has to say about Amy's business dealings because I think they'll pass the test.
They seem on the up and up. I want some trauma charms. I would love to accost people with my pain.
That's my favorite pastime. Oh yeah is it? What kind of things would be on your charm
bracelet of tragedies? Can you think of anything you put on there yes I would definitely put the time that my
mother got hit by a car that I was driving I happened to be driving it but it
wasn't my fault so would you put a car charm or just a carcass well Amy do you have
anything that's like a mom saying why and then like a car on a body like all
that in one charm. We have a wig that can that flies up and then we also have
you can order any early model Dodge. Oh wow. Because a lot of bad things
happening Dodge Darts.
I can attest to that.
Oh yeah, that's for sure.
And that'd be great, because then I can go to the grocery store with it.
You know, when people say, how are you?
That's a perfect opportunity to talk about your trauma.
You say, they say, how are you? You say, I hit my mom, with, I, I, the, the, the, th, th, th, th, th, th, th, th, I, th, th, th, th, th, th, I, th, I, I, I, I, I, I, I, I, I, I, I, I, that, that, that, that, that, that's, that's, that's, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, th.. And, th.. And, th.. And, th. And, th. And, th. And, th. And, th. And, th. th. that's, that's, that's, that's, that's, that's, that's, th. that, that, that's, that's, that, that, that's, that's, that's, that, that's,? And you say, what, when did it happen? Oh, when did it happen?
Oh, like a few days ago, she's recovering.
Oh, that's recent.
That's a recent thing.
Well, and we can get that to you just as,
as soon as you have the trauma, it's overnight now.
Oh, that's what I like.
That's a good business plan. Yeah, that sounds, that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's. And that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's. that's that's that's that's the. the the. the the the th. that's what. that's what. that's what. that's what. that's what. that's what. that's what. that's what. that's what's what's that's that's that's a good business plan. Yeah, that sounds right. So you got a car and a like a flying wig right next to each other.
And then, but you can get the wailing face of a mother.
The hair, you know, is, sometimes you can put, you know, whatever hair style you want.
So it can be a wailing mother charm, but I don't know, you know what, hair style you want. So it can be a whaling mother charm,
but I don't know, you know, what you would want.
There's so many options.
Do you have any with Guy Fieri hair?
My mom has Gaffierry hair.
Yes, we have Guy Fieri.
Beautiful.
And that's, that's, would probably be a perfect and then it's, it opens up a, it's
a conversation starter.
Lacey, how do you figure it wasn't your fault that you hit your mom with a car?
Because, but I don't know a lot about cars.
As far as I know, pedestrians, always have a right away.
Well, I hear you.
But you know, as a scammermer I've taken no accountability and I have a mantra that is I take no responsibility
It's really I went to a retreat once and it really opened me up to realizing that I don't have to be responsible for anything and anybody
Oh, really? Who sponsored that retreat? That sounds like an interesting retreat. It sounds like Joel Olstein. Oh, yeah. Christian Prosperity preacher. It was actually his cousin. Oh? Oh, oh, oh, oh, oh oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, I I I I I I I, I, I I I, I I, I I, I I I, I, I I I, I I, I I, I I, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, that, th. Oh, th. Oh, I th. Oh, th. Oh, th. th. th. th. th. th. th. th. th. th. th. th. th. Olstein. Oh yeah. Christian Prosperity Preaching.
It was actually his cousin. Oh, Cole Allsteen.
Coal. Joel and Cole? Ohsteen boys? Yes. Okay. I have a follow-up question about your mom.
Now, she have Guy Fieri hair, head to toe like chin and all that and whatever elements
head to toe also encompasses? She has Guy Fieri hair on her head and then also
her knuckles resemble Guy Fieri's knuckles as well. Oh he's got that mid-digital
kind of braided, this just fringy hair I know what you're talking about.
My well actually I have that but I was gonna blame it on someone else, but I didn't
have that.
And Google Gaffiery's hands.
He has soft, smooth, baby man hands.
Does he really?
Yeah, for real, Google it, for real.
I'm doing it right now.
All right, Mud, you Google that.
And I'm gonna ask Lacey in the main time. So you're gonna ask Lank the to to ask you, I, I, I, I, th, th, to ask, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th. th. th. th. th, th, th, th, thi, thi, th, th, th, th, th, th, th, th, th, th, th, th, th, th. th. th. th. th. th. th. th. th. th, th. th, th. th. th, th. th. th. th. th. th. th. th. th. th. th. th. th. thi, thi, thi, thi, thi, thi, to, to, to-a, to-a, to-a. G. G. Google, to-a. Google, to-a. Google, to-a. G. Google, to-ams and conmans and all that business, right?
Yes. Can you give us an example? Give us an example of the type of kind of guy you talk about,
you talk about real life scammers and people who've really scammed people?
I talked about real life scammers and they reach out to me if they're not in jail sometimes,
recently a rapper named Chad Focus, who spent over a million dollars on company credit cards trying to promote his rap album he's out of jail now and he said he's
chilling in his mansion and he appreciated the episode shout out to Chad
wow oh gosh that's a great idea
company credit cards what do you mean he did he took out credit cards in his own
name or in the name of somebody else's company or
he works for a company and they gave him an amex and he What do you mean? He took out credit cards in his own name or in the name of somebody else's company?
He worked for a company and they gave him an Amex and he saw his opportunity to scam X and
that's when he started buying billboards and gold chains and taking photos on Jets.
I see. He must have figured that the album was going to sell so much right away that he'd be able to put that money back in there and nobody'd notice? I don't think he had a plan, but his music slaps.
So it's good music.
Yeah, listen, I don't know nothing about no rap music, but is it unusual to have a rapper
named Chad?
Actually yes, but these days you can be named anything.
I know a rapper who's named after a credit car swiper.
What's it?
What's that?
What's the name?
What's a name?
TKJX6?
I'm not joking.
You use that to swipe a credit card?
Is that one of them when you hook up to your iPhone or whatnot and you scrammed
the card right there and you're...
I think it's one that you have to hold because he said he looked at the bottom and that's where he found it. Other rappers are like there's Duh baby, little baby,
young money, young rich, never broke again. That's one name. It's also a sentence. Oh I like what it's going because I named a kid Netflix.
You did? Yeah. That's a good name. Everybody loves Netflix. Your kids
gonna do well in life. I hope so. Yeah. President Netflix. Oh, oh, come on now. I
don't know if I could ever be the father of president. All right, I'll do it.
That's a lot of responsibility. You have to try not to fuck anything up for four whole years.
Hard work. Yeah, me as best as the parent. Yeah, you're right. I can't play to play to play to play to play to play to play to to to to to to to to to to to to to to the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. the. the. the. theck. thexxxx. threat. threat. thex. thex. theat. theat. theat. theat. theat. theat. theat. th. th. th. th. Hard work. Yeah, me as best as the parent. Yeah, you're right. I can't play
saxophone or, you know, drink myself to death. Nothing. Did your wrapping friend ever try multi-level
marketing and have a gathering? Oh, no, he did not do that, but I do know some multi-level
marketers like Tyra Banks. Oh, I was watching.
What is she saw? Tyra Banks. Oh, I was. What is she?
So.
Tyra Banks had a beauty line.
Um, I can't remember the name of it right now, but it's a multi-level marketing, a beauty
scheme that Tyra recently shut down like in the early 2000s.
I think she is a big con artist because I can, now this is Muttail Ta talking, but I also have a friend named Matt Gorley and he once went to Dell Taco with her on a real fluke and she says I ain't got no money can you buy
me a seven-layer dip burrito or whatever it's called that's a true story.
Wait a minute. This friend of yours yeah Matt I get a lot of my stories from him
yeah I went to out for tacos with Tyra Banks why Well, he was with his good friend Fred and Robin was an old high school
show him at Tyra Banks, and they went out bowling, but first they went to Del Taco and she
didn't have a dime on her, I had to buy her seven-layer burrito.
That's what happens when you're a business woman, you stopped curing cash.
Or paying for anything. I just found the name of it. It's called Beauty Tainer.
That was Tyra Banks's multi-level market scheme.
What's that a is that a pun or a portmant to beauty tater like entertainer?
Yes, but with beauty. Oh, well. She'd love to get a basket of that product. She made 27 million dollars. Oh, oh my.
Good heaven. I hope Oh, God. That was good heaven.
I hope to God that was...
Referrals to friends.
But how is that possible?
Beauty Tainer is neither a beautiful or an entertaining name.
It cancels both out instead of amplifies the other.
I mean, I did take a marketing class once.
I just go on.
I can tell.
It was online, yeah. This is the early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early early to early to to to to to the early can tell was it was online yeah yeah yeah this is
the early days too is just me another guy but you don't know how to smize
how oh what it's my show me how do I do it it it's when you smile with your eyes oh that's another person yeah yes that works watch this I'll try it all right oh I don't want to call that a smi all to that thrown that tho tho tho that that that that that that that that the the the the the the the the the the the the the the the the tho tho the tho the the the tho the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the ty ty. ty. ty. ty. ty. ty. ty. try. ty. ty. try. ty. ty. ty. ty. ty. ty. the. th. that works. Watch this, I'll try it. All right. Oh, I don't want to call that a smile.
No.
No.
That feels like you might be on the toilet.
No, that's not.
It also looks like you aged 50 years when you make that face.
I don't know what it is.
It's real strange.
Yeah, it does. Wow, I really. I really. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. that. that. that. that. that that that that that that that that that that that that that that that that that that that's that that that that that that that that that that that that that that that that feels. that feels. that feels. that feels. that feels. that feels. that feels. that feels. that feels. that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that thi. thi. thi. thi. the. the. the. the. the. the. the. the. that's the. that's that that that that that hope that she made that 27 million
dollars after you got suckered into buying her a multi-layered taco. What do you
a burrito, a multi-level burrito. Yeah you should hit her up and get your
five dollars and 27 cents back because she has it. All right well if you're
listening tire and I think most of the world is first of all I apologize to my neighbor second of all you owe me I believe buck twenty nine nine to $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $. to $.00.00. to $2. to $2. to $2. to $ $2.00.00. to $2. to $2. to $2. to $. to. to $ $ $. to $ $ $ $ $ $ $ $. to $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $. to $. to $. to $. to $. to $.00.00. to.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.00.the world is. First of all, I apologize to my neighbor. Second of all, you owe me, I believe, buck 29 or whatever it was. And judging for inflation,
let's make that like you said, about $5. Yep. That sounds fair. Now Lacey, do you pull
scams yourself? You have some experience pulling scams yourself? Yes, I have pulled some
scams. Some I'm at liberty to say some statutes of limitations will not allow me at the moment.. You. Uh. Uh. Uh. Uh. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. If, to. to to to to to to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. the the the the the the the the the the the the the the the the the the the the the the the the the the the the. the the the the the the the the the the the the the the the toe. toe. to to to their to their liberty to say some that statutes of limitations will not allow me at the moment.
Uh-huh, yeah. But yes, I like to pull small scams because I don't want to hurt people.
Like for example, do you know that if you are in a line at any like place, like a retail place or any
normal place, psychology has taught us that people don't like conflict to the point where if you give them any excuse to cut them in the their their their their their their their their. their. their. their. to. to. to. to. to. to. Like. Like. Like, to to to to to to to to to to to to to to their, to to to their, their to their, to to to to to to pull. Like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, to to to to to me.. to me. to me. to me. to me. to me. Like, to me. Like, they. Like, they. Like, they. Like, they. Like, they. Like, they. Like, they. Like, to. Like, to. Like, to. Yeah, to. Like, to. Like, to. Like, to. Like, to. Like, to. Like, that people don't like conflict to the point where if you give them any excuse to cut them in line they normally will let you. Oh I see. So I
go to FedEx. Yeah, okay. And I'll be like my car is running outside. Do you mind
if I cut in line and they will say yes. Wow. That's good. I'd like to test your theory
that you could give almost any reason, like you just say, I, in my opinion,
you smell terrible. Can I cut in front of you? Because I think the breeze is blowing
this way. Right? Or I deserve to go before you. Can I cut in? No? But then he wouldn't say no.
They would say yes, according to your your prophecy.
Well, I said almost any reason and you both gave terrible reasons.
You insulted them.
Let me try one.
Oh no.
Try one, Matt.
Excuse me.
Pardon me, ma'am.
Did you know study show that just about any idiot will let you cut in front of them if you get real
conflicty? So back off, lady. Listen to bananas
for bananas for a banana for apology later. That's perfect. You mixed in a promotion. Well,
it took a marketing class. Yeah, that's real good. Yeah, I'm gonna try it next time I go to FedEx. Maybe
I'll try. Hey, I'm rich. I deserve to go in front of you. See if it works. These are the worst ones I've ever heard but please do try
them. I will try them. I have a baby in a hot car and the windows are closed. Let me go.
I have a baby in a hot jacuzzi let me go. I have a baby in the oven let me go. I have a baby in the oven.
I have a baby in the oven. I have a baby with I have a baby. Oh I have a bun in the oven. Simplify.
That's a euthamism for being pregnant. Right. Well I like it too if you just say I have a baby
but it's clear that you don't have a baby with you is just a lot of mystery. That's exactly how it goes.
I have a baby let me cut in this line but baby the cops might be called so be aware of that. Yeah but it's just the Fed the Fed Fed Fed Fed Fed Fed Fed the Fed Fed Fed the Fed Fed the Fed Fed the fed the fed the Fed Fed Fed Fed the fed th. th. th. th. th. th. th. th. th. th. th. to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to th. I. I th. I the. I the. I the. the. the. the. the. the. the. that. that. that. that. that. I to to to to to to this line. But maybe the hot car is fun, but also the cops might be called, so be aware of that. Yeah, but it's just the FedEx cops. You don't have to look at a little
baby. It's a very little baby. Yeah, that's worse. Tiny, tiny. Okay, good. Well, we've covered a lot of
ground here so far. Should we, before we get into the episode, oh, I was going to say it's a highly fortuitous Lacey that you're here for this episode because it does involve a con man
This episode is all about a con man pulling cons. It feels like we have an expert here to talk us through how
a Comstock fella what how good his game is you can tell him you can tell us if he's doing techniques and shit.
Yeah, he's charming. Everyone likes him. Youthough they don't want to. Yeah, he can't help her like this fella.
He's a carpet pagger for sure.
Ha ha ha! Damn a claim jumper!
Uh, all right, but should we get to it or should we hear, like we's gonna do now,
regular feature of this show, uh, an explanation of one or two or three of Amy
Sleverson's tragedy charms. I'm so excited.
Amy, is there a particular tragedy charm or two that you want to highlight for us or should
we just choose from what you what you got dangling there?
Well, I have not just when I wanted to showcase because it's on sale for 1999.
And if you buy before the end that this show is done, then you can get a $50 credit towards
more orders at Lost Daughters.com.
And it's a barbecue grill.
Oh, okay.
What's the tragedy there?
My husband left the barbecued in me and I didn't have an instruction book and I
it caught fire and I have third degree burns on my lower legs.
But, um, but we got, I did a nice job on the steak so I managed to keep them on, I put butter on it. I put butter on it and it. that and I didn't have an instruction to the book. the too book. And I didn't have an instruction book. the the book book. the the the book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book. the book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book book. the book. the book book. the book. the book book book book book. the book. the book. the book book book book. the book. the book book. the book. the book book book. the book book. the book book book book. the book book book. the book book. the book. the book book book book book. the book book. the book book book. the the book book book. the book book. the book book. the book book book book book. the book book book book book book book book. the book book book book book. the the the book book book book book book. the the the the the the book book a nice job on the steak so I managed to keep them on, I put butter
on it and I managed to not overdo them even while the emergency medical technicians were
coming.
You hung in there and you cooked them steaks even though you was burned.
He doesn't like him overdone.
Oh, right. If you're gone and taking a ride
in an ambulance to lift them stakes there on the fire, God knows what your husband would
have found. Oh, he'd have been so mad. He likes a little pink. Quick question, what if I
see a charm that you got for sale? I really like it, but I ain't yet had that tragedy. Could I buy the charm and then make the tragedy happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen happen the the the the the the the th. th. th. th. th. tragedy happen some way or how's that work? Well there's there's no telling what's going to
happen but something for sure will bad will happen to you and you can just assign
that to a charm. We have a charm that's the Apollo 13 and even though you know even if
you're not associated with that or nothing bad happen. You know you know even if you're not associated with that we're
nothing bad hat you know you can just say oh that reminds me of something.
Oh wow I was watching my husband has toe-funded and sometimes for whatever reason it's just he thinks about space programs.
My cat choked to death when I was watching Rocky 2 when Apollo Creed gets killed.
Oh, it's a perfect charm.
I believe you're talking about Rocky 3, my friend.
But uh... Oh, I do apologize.
You know, if my cat was choking, I was a little busy, so...
I suppose we can excuse the transgression.
But we also have a new line of charms
that represent all world religions.
So there's the star of David with six pointed star.
And then there's the, uh,
Yin Yang of, um, the Confucius, and then the Sikh double-edged sword
and the crescent of the moon of Muslims.
Ah, that's the Christ's cross on the cross.
Yeah, that's beautiful.
Do you have Cole Osteen's church?
I, all it, it just needs to look like a little cash machine with a tiny little
cross, but the cross has to be tiny. I will get on that because that sounds like one that will
really move. Yeah. Do you have a charm? What would you recommend if I wanted to memorialize on my
wrist the events of the 2020 Wilcox France exposition of all those things that went so goddamn sideways and forced me to blow
up my home.
How do you make gonorrhea a chawn?
Wow, there's so many ways to memorialize STDs. You can just put, you know, the, this, a small version of a free clinic or, um, or, um, um, or, um, um, um, um, um, um, um, um, um, um, um, um, um, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to to to to, to, to, to to to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to me, to me, to me, to, to, to, to-a, to-a, to-a, to-to-a, to-to-a, to-I-to-to-to-a, put, you know, the small version of a free clinic or if your
explosion is totally with a with a little stick a dynamite.
But a lot of these things are things you can just think up yourself and then we send the
desire to China and it's done within a week because there aren't any laws there.
Right, there's no laws to slow down the memorialization of your tragedy.
And that's a scam, right? What's a scam?
To not pay people very well to do good work and then we make money off of it.
Does that qualify as a scam, Lacy? What's going on with the Chinese people doing work?
That's called capitalism and it's the biggest scam.
It's my favorite. It's my favorite. It's my favorite scam.
I asked about the gonorrhea charm because earlier adults said that there was a gonorrhea outbreak at his ranch. Can you
put the ranch and then somehow include the gonery all in one charm?
Well when I think of that I think you could have a horseshoe and then had a horseshoo with a little tear trap attached to it. When because that would be the the treatment might be something that would be something the the the the be be the be be the be be be the be be the be the be the the the be be be the the the the the the the the the the the the the the the the the the the to be the the the the to be be to be to be to be to be to be to be the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the theymea outbreak outbreak outbreak outbreak outbreak outbreak outbreak outbreak outbreak outbreak toea toea.a treea toea.a.a.a.a.a.a.a. toea. toea. toea. toea. I toar trap attached to it?
Because that would be the treatment might be something that would be a bromide or a pomade
that you put on your genitals.
Yeah, that's the common treatment for gonorrhea.
That's the first thing the doctor says you put some pomade on your genitals.
Try that for 14 days. You can take it right from your hair and I tell you what I think
gonorrhea does it make you go blind so the tear could work there too? Because I
was blind for two weeks and I never got an explanation why until I talked to
this gal her name was sex. She, I was honest. Her name was sex?
Her name was sex.
Yeah.
Well, that saves time.
I mean, I should have seen it coming.
Yeah.
Yeah.
Yeah.
Yeah.
Sex.
Well, that's nice.
Yeah.
That's got ring to it.
Yeah.
Well, all right. All right, folks, I think we've covered the charms, we've covered the 2020 Wilcox Exposition
and all kinds of, we've met each other.
So this been a good time here,
but now I wanna start talking about episode nine,
season one episode nine of Bonanza,
the greatest television show that ever was.
And this episode was called Mr. Henry Comstock.
We're gonna talk about it. I don't to, I th th th th th th th want to say first off that this was a fantastic episode. It's got brawling. It's got some of the best shooting
we've ever seen on this show. It's got engines. It's got hop sing. It has all four of the-wall disrespect for women, it's got comical minors
and a city slicker.
Man, oh man, this one had every damn thing, didn't it?
It had two people who used a tanning salon much too heavily or were spray tanned.
You talk about the engines?
Well, I think the actors were, yeah,
they were clearly very thin people of Greek descent.
And blue-eyed Greek descent at that.
So kind of Southern Greeks, I imagine. I don't know, or Northern, I guess.
Yeah. Yeah. What, whatever they sprayed on them to make them look like Indians, man, it was good
because I fully believe those Indians. But all right, I think we're going to talk about all
that and a whole lot more when we come back from a quick break. That sound good
good from everybody. Yep. And then, well, when we come back we're going to talk all about episode 9, Mr. Henry Comstock. Lacey Mosley is here.
We'll see you soon. As women, our life stages come with unique risk factors, like high blood pressure developed
during pregnancy, which can put us two times more at risk of heart disease or stroke.
Know your risks. Visit heart and stroke.c. All right, welcome back to Bananas for Bananza.
We're talking about season 1 episode 9.
Mr. Henry Comstock.
One of the, we're just a fantastic episode.
I got some clips I'm going to show you. We're going to have a good time. Anderson's Fur Bonanza, we're talking about season one episode, Mr. Henry Comstock,
was just a fantastic episode. I got some clips I'm going to show you, we're going to have
a good time. This episode, it's got some good guest stars. As you know, I've been starting
to really look into the guest stars. A fellow, Henry Comstock is played by a guy named Jack Carson, who's got big parts and things you have, and thii to th.. th. th. th thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, they's thin, thi, thi, thi, thi, thi, thi, th. thi, thi, th. th. thi, th. th. they. th. th. th. thi, they. they. they. they. they. they. thi, they. I I I I I I's thi. I's thi. I's thin, thin, thin, thin, thin, thin, thin, thin, thi. I's thi. I'ma. I'ma. thi. I'm thi. thi. thi. I'm thi. thi. I'm thi parts and things you have. And he played a car salesman in an episode of the Twilight Zone where he's selling a
car that's haunted.
Isn't that something?
Isn't that something Comstock would do?
Yes, it does.
That's true.
Mm-hmm.
And then we had a, Chief Winamuck's daughter was played by a woman named Joanne Sage's and she was in 1958, she was Girl at Party in a movie called Shadows,
and then she was in this episode of Bonanza,
and then she never did anything ever again.
This is my husband's favorite episodes
because no women talk.
That, they sure don't, they sure don't.
But I did an inner monologue for all of them during the episode.
Whoa, what did they say?
They said, you, you have no idea what I am going through.
Yeah, that might be right. Well, she doesn't say a damn word.
And it's hard to imagine that she understood much of what Little Joe was explaining to her.
His hand gestures were vague at best.
But somehow she showed up at the dance on time, but we'll get to all that.
But something must have happened on the set of bananas that made Joanne Sage just say,
never again.
She never worked.
That's hard to believe the 1950s Hollywood would in some way lead to to to to to to to to to to to to to to to the to to to the to the to the to to the her to quit acting? I don't know. I don't know how that would happen. Then there's another fellow named Richard
Cutting. He played the fella at the end who's from Virginia. His character name
was Old Virginia and let me read you his bio on the internet movie computer. It
says in the 1950s Richard Cutting derived fame as manners, a tiny butler in a bowler derby hat
in a series of commercials for Kleenex napkins.
By trick photography, he appeared to be about only inches in height and would manifest under
a dinner table in a traditional butler's cutaway.
A paper napkin was always slipping off the lap of a diner, giving Manners the opportunity, after a polite, ahem, to inform the guest of the non-slip benefit of the Kleenex napkin.
Whoa, I just looked that up on YouTube right now. Oh yeah, oh hey, by the way, did you ever get a good look at Guy Fierry's hands?
We never did hear back about that. Yeah, they're soft as, if not more than a baby's bottom. Okay. Well, he uses so much butter it should be. It's right. the the the the the the the the the they. they. the they. the they. the the the the the they. the the they. the they. they. they. they. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. th. th. t t t t t t t t. t t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. be. Yes, right. Yeah, I think he also wipes his hands in the diaper cream, too.
Good for him.
Good for him.
Beautiful.
Yeah, and then this fellow Richard Cutting, he was also a forest ranger in a movie called
Monster on the campus.
Oh no.
And he was in a movie called Attack of the Crab Monsters.
And he was in a movie called Creature with the Adam Brain.
A-T-O-M.
And none of those movies have anything to do with the today?
Nope, they don't.
No, does Attack of the Crab Monsters have anything to do with Donorea?
I think it is an instructional film about STDs. Yeah, I had to watch attack the ca the ca the ca the ca the catatatatatatatatatatatatatatatatatatatat the ca the cra the cra the cra the cra the cra the cra the cra the cra the crab of the crae of the crae the crae of the c. the c. tha thiae. thia thia the. the. the. A thia thia thia thia th. A th. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. yeah, I had to watch that in school.
Yeah, you had to watch Attack of the Crab Monster? Yeah, yeah, that'll talk you out of
screwing around for at least a week. Well, let's see here. So that's a good good guest cast on this
episode as always. And this episode starts with all our heroes and they are, they stop for water by a lakeside or by a river.
And a bearded, a fellow, he's a, I guess he's a prospector
who every morning glues on a beard.
I was gonna say, there's a lot of false beards.
I mean, I think they just took the wig right off Lauren Green's hair in some cases
and put him on another man for coverage shots. They, well, th, th, th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th, and th thi thi, and thi, and thi, and thi, and thi, and thi, and thi's thi's thi, I thi, I thi, I thi, I thi, I thi, I thi, a thi, a thi, a thi, a thi, a thi, a thi, a thi, a th, a th, th, th, th, th, th, th, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi's thi's thi's thiiiiiiiiiiiiiiiiiiiiiiiiiiiii, thi, a shots. They had one for round. Well this fellow got time to glue on a beard. He comes out and he says,
hey you're on my land, but he's on the Ponderosa. And then we cut to the opening credits.
And this is according to the Wikipedia, this is the ninth episode of Bonanza to feature the
burning map in the opening credits. You know what else is interesting?
This is the second episode they shot, even though they aired it the ninth.
And I think that's why you're getting the origin story of Virginia City, which is referred
to in prior episodes.
Oh, yeah.
I was going to say this episode has more to do with the Ponderosa and the cartwrights than any of the ones we've seen since episode
one.
So that explains it.
I wonder what happened there.
I don't know why they pushed it back.
Strange.
Yeah, it turns out this fellow, who they keep calling old timer, but he seems to be about
the same age as all the boys. He says he bought a piece of land from Henry Comstock for $25.
They're on the on the Condorosa, the boys, the cartwrights all laugh and laugh and laugh.
They laugh so hard.
That's how I laugh when somebody asks for an advancement bonus.
Okay, they've been working with me for only a five.
Are you kidding me?
You haven't sold nearly enough salt shakers.
Yeah, this poor young old timer with a glued-on beard got conned out of $25 and they laugh and laugh.
And then they say, oh boy, old Henry Comstock sold this to you, huh?
And the screen goes all wavy for a flashback. And then the whole rest of the episode is about,
I don't know how long ago, how long ago is it supposed to be?
They don't rightly say, I don't think.
I didn't even realize totally it was a flashback till the end
when they flashed forward again.
Oh, really?
Could have been anywhere up to 2,000 years ago. When they're a Bible-stained dinosaur.
When they came to the Pondros and planted those trees, the first trees,
with Michael Landon as Jesus.
Yes, yes, Amy believes that Michael Landon is Jesus.
And this episode, this episode backs it up as they all believe that too.
I do. You've got me to that side of thinking. Yeah. Yeah, yeah, the the the to to to to the the to the the the then then thine, I I I I thea I to thea I thine, I thi. I thi. I to to to thi. I thi. to thia. thiananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananananan. th. th. th. th. th. th. th. the. the. the. the. the. the. the. the. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. that. that. th. th. th. th. th. believe that too. I do. You've got me to that side of thinking
Yeah, I want to show you my first clip from this episode because it takes place in the next
scene. The next scene after the credits is one of the longest scenes ever on this show and it is it has a
it's just a beautiful ode to trees. Has a whole lot of talk about railroads that doesn't have anything to do with the rest
of the episode.
It's unbelievable.
And I'm going to show a clip from that where I think, what's his name, Lauren Green, must
have won multiple Oscars for this scene about trees.
Wait a minute, God damn, I gotta share my screen.
Well, I'll tell you one th, track ain't nothing but a lot of rail.
Oh, yeah.
That's what I say.
I want to be in this riders room.
I feel like I would be the one pitching all the rails.
Like, oh, so this is a story about railroads.
Okay, but what about railroads?
Can we get more railroads?
I think wever for railroads. It seemed like it was going to be an episode about railroads.
For a moment there.
Okay, here we go.
This is Lauren Green, leaving it all on the damn field as an actor as to talk about
trees.
I hope you can hear it.
Us, there were trees that were living and grown in this forest.
They were old when Christ pulled fish out of the sea of Galilee.
Oh, cut unless you bled. That's right, Hoss. That's why we're here. Not just to take from the land, but to give.
Yes, sir.
Can you see it?
A hundred years from now, standing tall against the sky.
Planet Adam.
It's your point.
Oh, ho!
You're crying, mutter, you're crying?
It's just so beautiful. It's poetic.
It's a type of cowboy philosophy.
I just don't know what to say.
That's right.
That is a beautiful, you ever see a scene as beautiful as that in any other damn show?
No, they says plant before you cut.
Now, I will point out that they definitely cut before they planted, but... And they all cut off a very long tree.... treereereereereereereereereereereereereereeree. treeree. tree. tree. tree. tree. tree. tree. tree. tree. tree. a very long tree. It was a tree that they were beating down from the roots.
It took four hours to cut that thing down.
And I'm glad that he said the thing about leaves while you take,
because you know, they took all that land from the native people, but they left some trees.
Okay, you can't say they didn't leave a tree. They said you have the tree on their own land.
You got a treat.
Well now, I don't know.
If it's fair to say they took that land, they moved in on the land that the payutes were
living in, and they said, we're your neighbors now, and we're going to try and not rile you up. And then, uh... Dalton, I'm glad you said that, because I'm going to be moving in next to you.
I'm going to be moving in next to you.
And I'm not going to take nothing, but I am going to be in your home.
Okay, you're going to be in my home and you're not going to will bring you a small tree as well. Look, in defense of the cart rights,
they might have moved in on their land,
but at least they didn't take the Paiute's daughter princess in any way.
Oh, well, hang on.
Maybe you didn't see the whole episode.
Well, I'm currently watching it.
I'm not the cart rights.
There is essentially a thi the the the the the the the the the the the the the the the the the, you can't fault the carbrights.
I don't, I don't like any criticism of the carbrights.
I really do.
But anyway, uh, so now they hear some gunfire.
Oh, did I skip something?
I don't know.
Doesn't matter.
Oh, yeah, I skipped the whole part about how, uh, or did I?
I don't remember. and he's getting hung. And at this time, the city where he's about to get hung in
is called Hang City, apparently.
He lives in the town of Hang City.
Shouldn't be surprised he's getting hung.
But he manages to talk the guys out of hanging him.
And, and uh,
which is not easy to do in a place called Hang City.
It's like, what do we do here?
What else do you they they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're going they're going they're going they're changing the name of the town you're not going to be able to hang
people here anymore if you want to hang me you're going to have to if you want to hang me legally
you're going to have to go about a hundred miles and these idiots just go all right let's
ride together a hundred miles away to hang him. They have no problem with it. That's what happened to me when I was double-booked multi-level marketing at my girlfriend's house
and this one lady was trying to sell sex toys and then I was trying to sell, sell platters with God on them.
What do you do? You said if you want to sell those sex toys, you've got to go a hundred miles away?
I told her to get out. Oh man. You could have had a combo deal there. Get a plate with Jesus face
and you get a big pickle deal though. I would like that. Or if it was like a very sexy drawing of Jesus, they used to draw him very sexy. That's true. I didn't even think of that. That's why. That's. That's. that. th. th. th. their. th. th. their. th. their. their. th. their. their. th. their. th. th. their. th. th. th. th. th. th. to. to. their. their. to. to. to. to. to. to. to. to. to. to. to. to. to. their. their. their. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. the. the. the. the. the. the. the. th. the. the. th. to. to. to. to. to. the. the. the. the. the. the. the. the. the. th, that's true. I didn't even think of that. That's why I'm not a good sales person.
No, that's not. You're a hashtag girl boss. We all agree. Well, uh, anyway, so the cartwrights
go and they go to help out, uh, or whatever, they investigate these gunshots, and they see
Comstock on a mule with no weapon being shot at now by these four guys is trying to hang hang hang hang hang hang......... And,. And, their. And, th. And, th. And, th. And, to th. And, thi. I. I's a thi. thi. thi. I's a thi. to thi. thi. thi. thi. thi. thi. thi. th. th. th. th. th. th. I, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, th. And, these four guys is trying to hang them and I guess Comstock got away from them
they're trying to shoot them and the cart rides don't know
anything about the situation whatsoever but they decide to get involved
and shoot at the guys who is shooting, right?
Yeah.
So in Hang City the whole time they could have shot him,
but they were like, that's not what we do here. Well, it's not Shoot City. We only hang, so we can't use our guns right now.
No, no, it's Hang City.
You're right, it's not Shoot City, all right.
I follow.
You go to Sex City.
They're hanging them for being a claim jumper, by the way.
That appears to have been the charge.
And this is when we see some of the best damn shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting shooting ever seen. Unbelievable. All four of the carp rights take turns, trick shooting at these guys. One of them, Haas shoots off a guy's hat, Adam shoots a guy right
in a canteen, springs a little hole. Real quick. Yeah. The trajectory with which that bullet
goes into that canteen would mean that either the man or the horse would have to be shot and bleed out. I don't know how a canteen can get pierceded p pierced on the bullet inside. That's why you've got to have faith. Oh, yeah, okay. I didn't even think about that.
It's a mystery. Blasphemy. It's like the magic bullet that killed Kennedy. It's a magical damn
bullet. No, don't never mind where it went. And then, uh, and then uh, uh, and then, uh, then, what happened in a, oh, Little Joe shoots a guy in the shoulder, and then,
yeah.
Yep, and then Paul shoots a guy, shoots him in the rifle and splits his rifle in half.
Yeah.
And the whole time these guys are saying, oh my God, I can't believe how good the shooters
are who's shooting at us. However, they don't know what these guys are aiming at,
you know what I'm saying? Oh, right right right right right right right right right right right right right right right right right right right right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, th, th, th, th, th don't know what these guys are aiming at. You know what I'm saying? Oh right, they could be a 10 feet away aiming at their heads.
Exactly.
I would love to be such a good shooter that the people I'm murdering are like, damn, he's
really murdering me good.
Respect.
Oh, this is some good murder happening to me.
Yeah.
. I like your work and would like to die at your hand if I got to go. I'm proud to be murdered
by you. Y'all put that on my tombstone. Put on my tombstone. By the way, at some point, they
start talking about they think they must be getting shot at by devils. The shooting
is so good they feel it must be supernatural and must be the devil shooting at them. Yep. Yep. Yep, that's it's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. That's. It's. That's. It's. It's. It's pretty. It's pretty. It's pretty. It's pretty. It's pretty's pretty. It's pretty's pretty's pretty's pretty's pretty. It's pretty. It's pretty's pretty. It's pretty that's pretty that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's pretty. It's pretty. It's pretty. It's pretty. It's pretty. It's pretty. It's pretty pretty pretty pretty pretty that's pretty pretty that's pretty pretty that's pretty pretty pretty pretty pretty that's pretty pretty pretty that's pretty pretty that's pretty pretty that's pretty pretty that's pretty that's pretty that's pretty that's pretty that's pretty that's pretty that's pretty wild. It's really just a four co-dependent ranchers
want to get involved in everybody's business.
The cart rights.
That is a succinct way to describe the cart.
The carways have a terrible problem with it,
not keeping their eyes on their own paper.
Oh, yeah.
That is true. They had no reason whatsoever to get involved in any of this business at all. No, they have a real moral ambiguity from episode to episode.
I would say.
And why do they like the trickster so much?
Why do they have such an affectionate longing to save the top-hatted stranger?
Hard to say. Yep, they write up on this guy and they find out he's wearing a top hat, and he talks like a fancy pants city slicker, and he's on a mule, and he's running away
from some guys that are trying to shoot him,
and they say right away, I like this guy.
And they invite him over for dinner,
and Hopsing cooks up something.
Hey, this is the second time in this series, about the meaning of the term culinary arts. Culinary, that's how he said.
Culinary art?
Culinary from the city slicker.
Oh, the city slicker says it.
And then Hopps saying thinks he's been insulted when it's actually a compliment toward
his culinary arts.
Yeah.
That's a real go-to for this show. I love that scene because I loved loved how much the scammer Mr. Comstock really wanted to eat the corn.
To the point that he begs at one point for more corn when he's denied the corn.
I like...
You realize he's pocketing the corn, no, he's pocketing it for him and his mule on the trip and the journey.
Did you know that Hop Singh spelled backwards is Nispo which means he's probably representative of the
Gnostic gospel? Oh I never did. We need to keep an eye on him that he is is the true
wisdom of the entire show. I would not be at all surprised if the Chinaman turned out to be the true wisdom of the show. He, yeah he seems, he, he, he, is, is, is, is, is, is, is, is, the, is, the, the, the, is, the, is, is, the, is, is, the, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the true.e.e.e.e.e. true. true, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, is, the the entire show. I would not be at all surprised if the Chinaman
turned out to be the true wisdom of the show. He, yeah, he seems, at least we
know he can cook pretty good. All right, well we're going to keep our hand, we're
going to keep our eye on that. This is the scene by the way where the
Comstock says he grew up on the Frangatang Mountain and nobody bats an eye. They just, okay. He also speaks of having been a guest
at the Queen's Palace and they still like him and trust him after all that. And then he says
he's going to go out to the Washaw diggings and he's going to see what's going on out there.
These guys are all digging for gold. And then we learned, I believe it's around here that we learned that there's a dance. And we learned the big main problem of this episode,
which is that all the women at the Washoe Diggins is fat.
Yes, right, they take pains to say that a few times.
Again and again and again.
Before we get to the dance, can I just say two things that I was impressed by by Mr. Comstock. When you talked about the mountains and how he said he was from them, he also they asked him they said
well where else have you been and he said are y'all familiar with overseas and
they said no and then he said okay good I'm from Canada. That was a perfect scammer
move there. He was like what do y'all know about Somalia? Nothing, okay, I'm from there.
That was so impressive to me.
I was like, this is peak scam.
I love this so much.
Yeah, that was pretty good.
Although Canada is not really overseas, is it?
It is if you go south.
Okay, I get it.
I get you now.
That's right.
Yeah, you leave from the Pacific and your aim is to get to the, to the,
for a French Canada or some shit.
Yeah, well if you leave down through the like the, you could take a Gulf of Mexico and
go all the way down and then walk across the Antarctic and then sail back up to the Arctic the North Pole and come down. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. th. th. th. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. Well. th. th. th. th. th. th. th. th. the the th. the. Yeah. Yeah. the the th. the th. the the the the the the. Yeah. Yeah. Well. Well. Yeah. Well. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah, then you're in Canada. So... Or if you count the great lakes as oceans unto themselves.
Oh, right. Yeah, that's a good point. Well now, so, uh, okay, off goes Comstock with Hoss.
Hoss decides to trail him as a kind of a bodyguard to make sure he doesn't get into any trouble.
Why? I don't know. And then, little Joe says he's going to solve the problem of too many ugly
women, ugly fat women in the Washoe Diggins for the big hog down.
No, he did not say ugly. He just said big bone, strong, stropping women.
Okay. And so it's raw bone that were good at dancing.
But good at dancing.
Somehow he wanted someone delicate like his mother who died like all three of the mothers
that his father has impregnated.
Yeah, and there's a moment where Ben Cartwright talks to Haas about the mothers,
and it feels like when he gets to his mother, he's going to go into some sexual details,
just the tone that he had. And he didn't didn't didn't, th didn't, th didn't, th didn't, th didn't, th didn't, th didn't, th didn't, th didn't, th didn't, thuult thult thult thult thult, thult, thult, tho, tho, tho, thi, thi, the, tho, tho, tho, the, the, the, th, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii, thi, thi, to go into some sexual details, just the tone that he had,
and he didn't, so ultimately it was disappointing. He was almost as excited about his wives
talking about them as he was about that sapling in the first scene. It was almost the same level of passion.
Before he killed every one of his three wives, he said, plant before you cut.
And he impregnated them and he impregnated them and their their live alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive alive their their their their their their their their their their their their their their nated them and then kept them alive and stasis long enough to have the children and then did away with them.
That's exactly what happened.
Yeah. Yeah, do you know that? Lace of this? This is the premise of this show.
It's a poor Ben Cartwright has married three different women and they all died but they each gave him sons.
He says that in this episode. They left me sons, boys. They left me sons.
That's like reverse Henry VIII. Like he actually got the sons, but then they still died.
And still Cartwright managed to kill more wives than Henry the 8th even though he got what he
wanted. Now did he name the trees after his wives? He was like, that was Tarny. That was the trees named after him? I hoped so? He he he he he he he he he he he he he he he he he he he he he was like he was like he was like he was like he was like he was like he was like he was like he was like he he was like he was like he he was like he was tawning. That was Marie. And that was your mama, Jane.
Are the trees named after him?
I hope so.
Yeah, he does.
And he still goes out and has some intimacy with them from time to time.
Oh, you bet he does.
Dad.
Well, then we'll see.
A ponderosa cutting board.
That's the hole. It's thoooooooooooo. It's tha. It's tha. It's tha. It's tha. It's tha. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's tho. It's the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. It is. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's th. It's tose. It's tose. It's tow. It's to. It's to. It's to. It's to. It's tooooooooooooooooooooo. It's tree. It's tree. It's tree. It's to. It's t is. It's got a hole in it. Do whatever you want with that hole. Just like Muttailers.
Hauss and Comstock head down to the diggings.
This is where Constock does some real, does some great scamming and he comes in contact with a fill in a blue hat who's got one of the best faces and beards in the history of this show.
They say we get some scraggly miners down there. And Mr. Comstock says that he owns this whole land
and calls it to Comstock Lode.
And then he asked if he can go in as a partner
with one guy for $17 on a whole side of a mountain.
Comstock Lode was my nickname in high school.
I really love Comstock here because he displayed excellent scam skills. They walk up, he immediately says,
I own this land, and everybody says,
how, you just got here?
And he says, never mind that.
And I like that a lot.
And then he started a fight with the first kind of
scraggly little minor guy.
And why does the minor guy swing a punch and hit the other guy?
And then Comstock just walks away as the fight happens and starts to scam so the whole time he's scamming there's a
full-on brawl happening in the back he's like yeah never mind that never mind
that so you got some claims over here I got 17 dollars I know it was beautiful it was
wonderful yeah the one scraggly guy was gonna punch the other scraggly guy who had Bob Dylan's voice and he he but he he he he he he he he he he he he but he he but he but he he he but he he he he he he he but he he he he he he he he he he he he he he he he he the the the the the the the th tho-so he tho-so he tho-so he th is th is th is th is th is th is th is th is th is the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th is th is th is th is th is th is th is th is thus he thus he thou-I thus. theeeeeeeeeeeeeeeeeeeeeee is thou-I tho-I tho-I tho-I th is th going to punch the other scraggly guy who had Bob Dylan's voice. And he, but accidentally he screwed up and punched Hoss.
Oh no, I guess he was trying to, must have been trying to punch Comstock.
Comstock, yeah.
Yeah.
Yeah.
I had screwed up and punched Hoss and then Hoss, now has to take on the entire mining city population,
which no problem for him because as we've discussed before, he is a gargantuan like a sort of a Hulk like, he has unlimited strength.
He did it Tarantino style. Oh, how so? Yeah. Like when one person is fighting like lots of people,
so but instead of like ninjas that he was just fighting like real beat down a homely minors and they were coming at him and he broke a bat on a stick and he was fighting them.
It was good.
How many episodes in a row now is it that Haas has fought a bunch of miners?
Well it's at least two and that's what happens. They just say well they just piled, piled people
on top of them like 20 people will advance on them all at once. He throws them off like flies. By the way there's one the bra all the bra all the bra all the bra all the bra all the bra all the bra, the bral. T the bra, the bral. T the bra, the bra, th. th. T th. th. th. th. th. th. th. th. th. th. th. th. th. It's th. th. th. th. th. th. th. th. th. th. th. th. th. th. It's is is is is is th. It's is is is th. It's is is th. It's is is th. It is th. It's is is is th. It's is th. It's is th. It's is th. It's is th. It's is th. It's. It's. It's th. It's th. It's th. It's th. I's th. I's t. I's t. I's t. I's t. I's t. I's tos. I's t. I's t. I's t. I's tos. I'll. I'll. I'm. I'm. I'm.. He throws them off like flies. By the way, there's one moment here where the whole brawl,
the brawl moves in front of Comstock where he's talking to his new mining partner, and there's one
fellow in the whole circle of people who is trying to beat up on the hoss who can't get close enough to
to do anything except slap him on the top of the head. But he bunch of times. He gives him a bunch of slaps right on top of his head. I didn't see that. Oh, it's good. It's a hell of a fight move. That's a commitment.
That's a commitment to a fight. I'm gonna get in here somehow. That's kind of a something my husband and I do as foreplay. He likes the size of my head. It's big. It is big. I mean, it is all I see the thi. It is th is th is all th is all th is all the the th is all the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. th. thi. thi. thi. tip. tip. tip. tip. tip. tip. tip. tip. tip. tip. th., well, you do have a nice sized head.
It's big.
It is big.
I mean, it is all I see in the zoom screen.
It is an extra large head and you pat it and I don't know what feeling he gets, but it gets
to the next.
Oh boy, are you allowed to pat his head?
What happens you pat his head?
No. Okay. All right, I understand.
Well, you got a deadly serious. That's his body. It's his body. Okay. His body, his rules.
I get it. Well, so that we got little Joe up there. He's with the
Payute Indians. He's rode up there, trailing a piece of blue silk behind him the whole way.
I thought that was a signal to the Indians that don't attack me, you know, but it turns out
it's just a piece of fabric that he wants to give to Chief Winnamak's daughter, Saratucci.
And he wants to give-
Princess, Indian Princess, I mean, sure.
Okay.
I guess.
She's also related to Stan Lituci.
Saratucci.
Well, she looks more like Stanley Tucci than she does a native American.
So I will grant you that.
Yep.
It's just like pretty women.
The guy goes, here's a dress, wear it.
Exactly. Well, not even that. He shows up with just a sheet.
She got to still do the work.
He's like, here's some fabric. Make your own dress. I love you.
And she does it quick, too, by the way.
So, hurry up and make a dress and come with me to a dance tomorrow.
And somehow, she, I don't think she speaks a word of English or anything, and she understands, she, At some point, she's by the way, she is wearing a dress in this scene and little
Joe to demonstrate what a dress means puts this silk thing around his own body,
but she's wearing a dress. That was confusing. He could have pointed to it.
He might have just pointed to it just like that.
Yep. Then he described the river in a meadow with river and then meadow with a flat hand
river and then meadow.
And she's just nodding like, oh I got it.
Way the hand, flat hand.
Yeah, I don't speak a lick of English but I can just Virginia real like nobody's business.
What if she speaks a bunch of English.
Yeah she, I mean, she a chance to talk.
That's true.
People can speak English.
They never let her talk.
They're like, shh, we know you don't speak English.
Like, but wait.
Well, yep.
Now that takes us, yeah, what are you going to say there?
None of the women speak. Well, the women, the women, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, there, the, the, the, the, they. they. they're, they're, they's, the, they're, they're, they're, they're, they're, they're, they're, they're, they're, they're, they're, they're, they're, they's, they's, they's, they's, they's, they's, they's, they's, they's, they's. they's. they's. they's. they's. they's. they's. they's. they's. they're, they're, they're, the, the the the the they. they. they. they. they. they. they. they. they. they. they. they're, they're, they're, they're, they're, they're not union. Right.
Well, there's a remarkable scene with a woman not speaking.
Once we get to the hodown at Dutch Peets, where Haas is dancing with a lady in a red dress
and he calls loud as he can across the room. While he's dancing with this woman, he says,
see what I told you? Fat and ugly as a skunk.
And she just goes on smiling away. She, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, thi, thi, thi, thi, thus thus thus, thus, thus, thus, thus, thus, thus, thus, thus, thus, thui, thui, thui, thui, thui, thui, thuase thu and thu and thu and thu. thu and thu. thu. th, thi, th, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii., yeah, I think I don't know if it
was established that that woman was deaf but that would make sense because
then we see a fair bit more of that woman and she doesn't say a word.
She never says word. She's just loaded on tarantula juice. Oh yeah, that's what
it doesn't make any sense because she's beautiful. Yeah's a beautiful rosy-cheeked young lady.
That's true, but just not Hoss's bag, I guess.
Hauss likes a woman who's dying of consumption, as we've already learned in previous episodes.
All the cartwrights like dying women.
I think it's a fear of commitment or heterosexuality.
I don't know what else. It's crazy because you could just leave.
You could just leave the woman, but it's like, no, she has to be dying.
Yeah.
He's like, I saw a beautiful woman with Typhoid on my way out of the saloon.
Oh, episode two.
Sarah, Gucci looks tanorexic.
Yeah, shunderexic. Yeah, like she's not eating enough and she's going to to to to to the sun the sun the sun the sun the sun to the sun the sun to the sun to the sun the sun the sun to the sun to the sun to the sun to the's not eating enough and she's going to the
Sun Salon too much. Yeah, she's very very small. That's the Sun Salon.
As aka outside. Yeah, the Sun Salon. I'm going to the Sun Salon a lot. You can
I want to show you charge people money for that and it's kind of a scam.
And I will.
Let's watch a scene here. I got another scene for you guys if I can find it.
Where the hell is my damn somewhere's.
Dang it.
All right, hang on. Everything's fine. Here we go.
This is a scene where where he walks in.
This is Little Joe arrives at Dutch Pete's for the Hodown with Saratucci's
daughter of Winamucca and here's the reaction. Okay.
It's coming back. That is a completely incompetent line dance calder.
He is just mumbling along to the tomorrow tip from the other hand to the right
get for the whole towards. Now you're howling snakes and ringtail screamers.
That's what I call a real hunk of woman. Yep. Wow. What was that line? I wrote it down.
Oh, howling snakes and ringtail screamers. That's what I call a real hunk a woman.
Beautiful, beautiful line. Poetry. It's poetry. It's he, was he a rapper? He was the first country
rapper because he sounds like little nice acts of Vanez. Yeah, that's that's Old Virginia.
And he is in the episode. That works asthe rap name. Old Virginia, it doesn't.
Old Virginia does.
Yeah.
He is there exclusively and talking about Virginia for like a half an hour of this episode,
just so that toward the end of the episode we kind of understand why they named this
town Virginia City instead of Hang City.
That's about it.
I did a little looking into what tarantula
juice is. You want to hear. Oh okay. Yes please. Yeah so it's a type of gin that's
laced with strychnine the poison and apparently you would get much the same feeling
as you would if you were on methamphetamines. Oh it was a popular practice to get
two pictures of it one to get you hammered and then one to drink the next the the the the the the the the the the the the the the the the the the the the the the the the the tu tu tu tu tu tu tu tu tu tu tu tuance. Okay. Okay. Okay. Okay. Okay. Oh tooeocea. Okay. Okay. Okay. Okay. Okay. Okay. Okay.ocea.ocea.ocea juice. Oh tuce. Oh. Oh tuce. Oh. Oh. Oh. Oh. Oh. toye. toye. toye. toy. toy. toy. toy. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. te. It was a popular practice to get two pictures of it, one to get you hammered and then one
to drink the next morning when you wake up with your skin feeling like it's crawling
with tarantulas.
So you drink it then.
Hair of the dog, but in this case the hairy legs of the tarantula.
Wow.
Wow.
They made it sound sexy. Real good stuff. Strap where you don't pick your skin off.
I know.
Wow.
They made it sound sexy.
Tarantula juice sounds good, but then when you said I'm going to start picking my skin
off in the morning, I'm starting to reconsider.
Yeah, but it still sounds fun.
That could be.
I mean, I've had some.
Yeah, you tried it.
Mm-hmm. And what happened? Where did you try it? I peeled my arms off
Oh, oh, okay. Yeah, yeah, I don't want to do that. I don't know if I'll drink that. No
I so certainly certainly it looks like I'm wearing a long-sleeve shirt with my sleeves rolled up, but that's my skin and I have a hole through the side of my torso So yeah, I keep Christian nutritional supplements so I can clean the house.
I'd take some of those if you got them.
What's in there?
They're called God Help Me Pills!
What's in there?
Does it make you all speedy?
It's just God's caffeine.
It's just a little roast coffee and a pale form.
Jeez.
All right, all right.
All right, no problem.
That's like them meadows, right?
Yeah.
Yeah, yeah.
Yeah, well, yeah.
But I do sell those two on the side
if anybody needs to supply.
I do. I'd take some. Yeah, me too. Well, so okay, it's it's it's, it's, it's, it's, it's, it's, it's, it's, it's a, it's a, it's a, it's a. It's a. It's a. It's a. It's a. It's a. the. the the. the the the. the. the. the. the. the. to. to. the the. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. I. I. I. I. I. Yeah, the. Yeah, the. Yeah, the. Yeah, the. Yeah, the. Yeah. th. Yeah. th. Yeah. th. th. the. the. the. the. the. the. the. the. the. the. the. the. the. the. t. t-. t-. t-. t-. t-. t-. t-. t-. t-. to. t-. to. t-. t-. t-. t-. t-. t., mm-hmm. Yeah, me too. Well, so okay, it's a real old hold down,
and then Little Joe plants a kiss on Saratucci,
and then bang, in comes Chief Winamucca.
Chief Winnamucka walks right in.
And the fun time is over, and then I'll play this little scene,
because this is another, this is really the best shooting scene we've ever seen on this
show. It is remarkable. Okay, so this is a scene here, there's a little bit of a confrontation after
Joe has kissed. Is this what I wanted to show? That's the end of the other one.
There she is. A robber gal. we go. Oh yeah, rubble.
Here we go.
Ah, congratulations, friend.
I haven't been to a wedding for a long time.
You know I had an uncle once, Uncle Jonah.
Not the one that got himself swallowed by the whale, no, sir, is a different fellow
fellow.
His Comstock.
A mother's brother.
One that never did a day's lick of a tha the to work work work work work work work work, Comstock. Yeah. I think you've done enough talking for one night.
Well, I ain't had a chance to kiss the bride yet.
Oh, no.
Oh, wow.
So what happened in that scene was, uh, Comstock is going to go and be the second person tonight to kiss the Indian princess. And, uh, uh, uh, and her husband, and, the husband, the husband, the husband, the husband, and, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the the the the the the the the the the the the the the the the the the the the the the the the the the hea' hea' hea' hea' hea' hea' hea' hea' hea' hea' hea' hea' hea' hea, hea, he he he he he he he he th th th th th th th. I th. I th. I th. I, th. I, th. I, thi. I, thi thi that, that, that- that-he that-hea' the tho tho tho the tho tho tho too too than too than than that and be the second person tonight to kiss the Indian princess and her husband to be, lean knife, pulls out his knife and
little Joe elbows him in the gut, but he's about to stab Little Joe and then he gets
shot in the wrist or the hand, but not in a way that causes the skin to break in any way. There isn't any blood. I love how long it was taking him to try to stab the man.
Like he had the knife out and he was like in stabbing time. I'm a stab you just long enough for
somebody to get a gun out and shoot it out of his hand. The way I took it was that the bullet
bullet went nowhere near him but just coincidentally he got he he he he he he he he he he he he he he he he he he that was it was it was that that was that was that was that was that was the that was the the that was the the the that was the the bullet went nowhere near him but just coincidentally he got a mean wrist cramp at the time because it's just maybe that was it
the actor first he grips his wrist and then he slides as a hand up to his
hand like it's kind of like I forget where they told me I get shot in the
wrist with a hand. There was a little smoke by his wrist though so oh oh nice okay well they took great pains when the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. the. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the a the a the a te a te a tria tria. tria., yeah. Oh, nice. Okay.
Well, they took great pains when the little Joe shot the guy in the arm in the beginning
to put a little squib, pyrotechnic there, but they just ran out of money or time.
I don't know what.
Something, but this is another one of those shots where it doesn't really seem to
hurt him. They just make them say, oh, okay, I'm not going to do that what I was planning on. Yeah, they change your mind. It's a mind changer.
Yeah, it's just a little bee sting. Just a little bee sting. Well, guess who shot that
done? It was Adam Cartwright with Ben Cartwright and they have shown up just in the neck of time to intervene and prevent little Joe from being scopped by Chief Winne
of Mukka for stealing his daughter in a beautiful blue dress.
And Ben says, if anybody's going to punish my boy, I'm on a punishment, chief leaves, and
then there's all this confusing nonsense about gold in the hills and all that stuff.
Comstock ends up getting, he pays something, he sells the land for $11,000 and
there's millions of dollars in gold and silver up there or something, who cares? But it does
go on to be called the Comstock Load for evermore, and then at the very end we learned why they
named this town Virginia City and the reason is that some drunk old Virginian poured some
liquor on the ground and baptized it as part of Virginia and Comstock decided it should sound like more of a city so he said
he had a city to it right? Yeah. Oh my gosh that's such a long road to go for the payoff.
That's like when I try to sell my nested baskets and go through the whole book of ruse.
You read a whole book from the Bible as part of your sales pattern for the nested baskets?
Yes.
Yeah, that's it.
By the time I've done, they say, ah, just put me down for four.
Well, then it works.
That's good. Well, there you go. That it works. That's good.
Well, there you go.
Now, I'm sorry to say that after this, we only have 422 episodes of Bonanza left.
Can you believe it?
You believe that, Lisa?
They only made 431 episodes of this show across a mere 14 seasons.
It's unbelievable, especially with so much railroad. I know.
They ain't even started laying down that railroad yet. And the wonderful thing is
they refer to Comstock and that he passed away and that he's in heaven now, and
that's where we're all going to heaven. That is beautiful. And then I believe
the last sort of joke of the episode is them speculating
that even up in heaven Comstock is still jumping claims.
He's taking clouds away from other angels.
Yeah, he is. He's stealing clouds and mining for cloud gold up there in heaven. That's beautiful image.
Well, sir, any other final thoughts about this episode, final observations, anything else?
I think it was a wonderful one. Man, oh man. I loved it. It was fun.
It was philosophical. I liked it. It made me think about things. I wish the Comstock had been a little better of a scam. He couldn't keep up with his lies. That started to happen to happen to happen to happen to happen to happen to happen to happen to happen to happen the to happen the the the the their their their their their their their the about things. I wish that Comstock had been a little better of a scammer. He couldn't
keep up with his lies. That started to happen a lot where it was like, wait a minute, you told us
this. And he was like, oh, oh, yeah. And then when I was with Queen Elizabeth, y'all know who I call a Lizzie. Then when I was with Lizzie and them at the royal palace, I was like, come on now, Comstah. Com, come th. th. th. thia, come thia, come thia, come thi, come thi, thi, th, thi, thi, th, th, th, th, th, th, th, th, th, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, wa thi, wa thi, wa thi, wa thi, wa th, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa, wa th. th. th, wa th. th, wa th. th, wa th, wa th, wa th, wa th, wa th, wa th, th, th, th, th, th, the, the, the, the, that that that's that's that's that's like, that's like, that's like, that's like, that's like, thi, thi, thi, any other decent scam. Is that what they do?
Do they couldn't lie journal?
Yeah, you're like, July 4th, today I said that I went to Queen Elizabeth's palace
and did shots off of her bullism.
And then you know, you just know that you did that.
Yeah, see, that's smart.
You gotta keep up with your lies. Yeah, absolutely. Amy, do you, uh,
where are you all lying?
You don't, is that a bad thing to do with the Bible?
I encourage, that's what I do.
I love the smell of bread and the sound of laughter,
and cleaning up and catching up and catching up with friends and family.
And I do keep a record of who I sold the
serving spoon to last. Yeah, beautiful. That's just beautiful personal statement. All right,
anybody got anything to plug? Anything coming up? I got nothing now. I've just got to find
a new ranching situation or something. And I think, by the way, I'm laying low for a while. I'm
I'm staying at a holiday in now. I got out some new ranching situation or something. And I think, by the way, I'm laying low for a while. You know, far as the law is concerned,
Dalton Wilcox died in that explosion. So, you know, just till the heat dies down. I'm laying low a little bit.
Yeah. All right.
Making your own death, I'm proud of you. I'm very proud of you. That's the ultimate scam.
Scam.
Yeah.
Oh yeah.
Hey, they ever find Olivia Newton John's husband?
Do he ever turn up?
What?
What?
What?
Is this a recent?
Uh, what?
What?
What?
? I'll look at him. He disappeared. Everybody thought he faked his own death. How recent did he disappear?
Two or three years ago.
Oh, I'm looking it up right now.
Hardly there's anything to do.
I do have a new product line.
Okay.
Bolts of Blue Claw that you send women in your life.
Oh, from this episode. Yeah, and you say, you say, get dressed. And you say, put it, put
on something nice, you know, but you just send them the cloth so they have to do all
the work. Because that's what women do. Is all the work. Yes.
Emotional and physical. Oh my. I think that's a beautiful idea. Here, take this big blue sheet and
damn it, get dressed. Turn it into exactly what you're wearing there except made out of this.
I did that to my gal Pris and it just sat there. Oh, oh yeah. And you handle all the
repercussions of me leaving my tribe and my father and my fiancé.
What did you find out about Newton John's hubby?
It's a little confusing. I think there's a headline here.
Olivia Newton John's former boyfriend found in Mexico after going missing 12 years ago?
What? The former boyfriend of Olivia Newton John has reportedly been discovered after going
miss.
He's an American cameraman.
That's what I want all my former boyfriends to do.
Oh yeah.
Go to Mexico for 12 years.
And don't come back.
That's not a bad idea.
And teach painting workshops in San Miguel de Jende. Yeah. Yeah. Yeah, the Coast Guard says that he, uh, they'd they they they they they they they they they they they they they they they they they they they they they they they they they they they they'd they'd they'd they'd they'd they'd they'd to be to be to be to be to be to be to be to be their after to be to be to be to be to be to be. But to be. But he to be. But he. But he. But he. But he. But he. But he. But he. But he. But he. But he. But he. But he. But he's. But he their. But he their. He to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be their to be to be to be to be to be to be to be to be toe, I to be to be. I to be. I to be. I to be. I to be. I to be. I to be. I to be. I their says that he thought he most likely drowned, but the circumstances
around his disappearance triggered speculation that he faked his own death.
In 2009, old Dateline got involved.
He disappeared to avoid debts, included $8,000 he allegedly owed to his ex-wife for child
support. So anyway, that's a fun story. He disappeared for $8,000 he allegedly owed to his ex-wife for child support. So anyway, that's a fun story.
He disappeared for $8,000 for...
That's a very low amount of money to disappear your life for.
Listen, I owe somebody $1,500, so we got to disappear.
Give me a stick and a bandana. We're going to Mexico.
He did it. He pulled the trigger on the fake death for eight grand.
It's a little too early. It's a little too early to disappear. He was also compounded with interest for a couple year at least. He could have gotten that from Olivia Newton John on any given day. Right.
I would think so.
Hey, tap into the Xanadu money.
I screwed up.
Oh yeah, time to, I know you ain't spent a lick of that because you've been just rolling
in on the royalties for physical, but let's say we open up that Zanadu coffer.
It's either that or 12 years in Mexico.
Hey, you ever th th th th th th th th think, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, 431 episodes we ain't got nowhere to go we do a
true crime podcast because that's what this feels like. Hey yeah, it does. I like it. I like it.
All right, so we're plugging our true crime podcast, which is going to be, by the way,
recently, Mutt and I figured out it would take eight and a half years at the rate we're going one every two weeks to get through every every every every every every every every every every every every every.......... And, the. And, to, to, to, to, to, the, to, to, th. And, th. Yeah, th. Yeah, th. Yeah, th. Yeah, to be, to, th. Yeah, to, th. Yeah, th. Yeah, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, to, to, to, to, th. I. I. I. Yeah, th. I, th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. to, to, to, to. to. to. today, thi. Yeah, thi. Yeah, thi. going, one every two weeks, to get through every episode
of an answer that was ever made.
Yeah, but we got it, we can do it.
We can do it.
If you don't do it, just go to Mexico.
Just go to Mexico for 12 years.
And that's how we'd stop, we'd have to stop the podcast.
We'd have to's the only way this podcast is ever going to end.
All of us will disappear on a fishing boat.
All right.
Well, thank you so much Lacey for joining us for this one.
You can listen to Scam Goddess, the podcast, right?
Yes, on any platform. And if you want to follow me online, DIVA LACI, Diva Lacey.
Okay, do that.
All right, everybody.
We'll see you next time.
So long! Bananas for Bananza is brought to you by Andy Daly, with Maria Bamblin of Matt Gorley,
theme sung by Matt Gorley, with the German, which in this case are Mark McConnville,
Daniel Murchikoff, and Wade Ryan. Special thanks to our gang on the ground, Josh Richmond
and Shannon Locke.
Bananas for Bonanne Connorse and Matt Gorley, and executive produced by Colin Anderson and Chris Beck. We'll see you next time. You
