The Daily Show: Ears Edition - TDS Time Machine | Billionaires

Episode Date: July 26, 2025

Billionaires... they're just like us. Give or take a billion dollars. Join The Daily Show in exploring the ups and downs of the lives of the very rich. Jason Jones meets with psychologists helping p...eople cope with Sudden Wealth Syndrome. Jon Stewart talks about how attempts to close the wealth gap are vilified as class warfare. Jon pits the Very Rich against the Very Poor with help from John Oliver and Jason Jones. Lewis Black looks into the stupid stuff the rich spend their money on. Trevor Noah and Ronny Chieng dig into tax evasion strategies, and Michael Kosta unpacks the plight of an Australian billionaire who doesn't like her portrait. Learn more about your ad choices. Visit podcastchoices.com/adchoices

Transcript
Discussion (0)
Starting point is 00:00:00 You're listening to Comedy Central. There's a great deal of talk in this country about people picking themselves up by their bootstraps to better their lives and fight their way into the 1%. But is it worth the climb? Jason Jones has more. Amongst all the terrible news about people who've lost their jobs or their homes, there's been one group that's been overlooked, the extremely wealthy.
Starting point is 00:00:37 Luckily, psychologist Dr. Steven Goldberg and psychotherapist Joan DeFuria have been there to help. Well, an average client is 25 to 50 million and up. Generally, people come to us who do not have to work another day in their lives. So why do they have problems? I know it sounds very odd. Yes.
Starting point is 00:00:56 But the climate today is very different than it was 10 years ago. We're really angry at the haves right now. And so what happens because of that is the wealthy end up hiding themselves in these gated communities. When I think about these people I just feel bad and I just want to punch them in the f***ing face. The wealthy are people too. From the trust belt in Connecticut to the tech ghettos of Silicon Valley, the rich are being unfairly vilified.
Starting point is 00:01:22 But DeFuria and Goldberg's research at their Money, Meaning and Choices Institute slash website has identified an even more serious problem. We coined the phrase sudden wealth syndrome. Sudden wealth syndrome. SWS. To describe the psychological issues and symptoms that many people experience as a consequence of coming into new or sudden wealth. They have problems.
Starting point is 00:01:42 And that's why we coined the term SWS. If you contracted SWS, could that ever lead to full blown RBS what's that restless Butler syndrome. We're not going to buy on that date next question, I'm sorry I'm sorry making up a condition in giving it an acronym to make it sound more legitimate is pretty foolish. Sure the poor in the middle class are worried about having enough food, but the wealthy have to worry about whether or not their waiter is recording them while they mock half the
Starting point is 00:02:13 country. It's a painful reality that afflicts at least 1% of the 1%. So let's say I've created a hot new app. Right. It's called DickWidget. Okay. Now I'm worth $idget. Yeah. Okay. Now I'm worth $100 million. Can you help me?
Starting point is 00:02:28 Well, we begin by asking you what... DickWidget is, yes. Well, no, I don't really care what DickWidget is. Well, no, DickWidget is an app that draws on people's faces. So it doesn't really matter how you made your money or what, you got it. You got lucky?
Starting point is 00:02:40 Well, not really. DickWidget was very popular. Yeah, but we don't really know what the details of your business. We really need to understand why it is you're coming to us. I don't know. You tell me. You're the shrinks. What are the needs and wants that you have that have nothing to do with your pocketbook anymore? For example, if I gave you this briefcase, and it was filled with millions of dollars,
Starting point is 00:02:56 and you, Jason, you got it. All right. You feel pretty damn good right now. You feel pretty good right now, and then what's going to happen? What are you going to do with your life? I don't know. Coke, hookers, witness. So this is what we call the honey moon phase of getting money. Okay. You've done that for a while, and then what's gonna happen? What are you gonna do with your life? I don't know, coke, hookers, what else? So this is what we call the honey moon phase of getting money. Okay.
Starting point is 00:03:07 Done that for a while, and then what's gonna happen? More coke, more hookers. Most people find after six months or a year, and they say, well now what? We're all gonna die, so in between the time between now and when we die, what do we fill our time with? Get down to business, open a nightclub called Double J's. And then what would you do?
Starting point is 00:03:23 Start a basketball league on jet skis. Let me get happy. Yes, I do not see a bad outcome here. But only after walking a mile in a rich person's $4,000 fair agamos did I truly know the paralyzing anxiety of sudden wealth. We are pleased. Thank you very much. It's table salt.
Starting point is 00:03:50 Yeah, I did it and as the developer of the revolutionary app Dick widget and creator of the world's most popular sport. I was glad I had mental health professionals like the fury and Goldberg to help me confront my demons. You're now a rich guy you're like dozens and dozens of people here in Silicon Valley and all of a sudden no longer Jason the computer program. It's coming out your cheek.
Starting point is 00:04:17 Thank you doctor Goldberg feeling better already. better already. There is an ongoing argument in this very country about how best to close the enormous deficit that we have incurred. The Republicans have proposed doing it entirely through spending cuts, whereas the Democrats have bravely fought back, insisting we do it almost entirely through spending cuts. Well, this week, bizarrely, un-eccentric billionaire Warren Buffett... entered the fray. The billionaire says,
Starting point is 00:05:00 While most Americans struggle to make ends meet, we mega- rich continue to get our extraordinary tax breaks. My friends and I have been coddled long enough. I pay a lower tax rate on much of my income than my cleaning lady does. Well to be fair, Warren Buffett's cleaning lady is also a billionaire. Warren Buffett's op-ed was a thoughtful treatise on the advantages the super-wealthy currently enjoy at the hands of the tax code. Or to put that another way.
Starting point is 00:05:34 Up next tonight, Warren Buffett's class warfare. More class warfare from an affable billionaire who should stop assuming the rich are all billionaires. Warren Buffett wrote an op-ed. Is he completely a socialist? Is Warren Buffett a socialist? You really have no f***ing clue what socialism is, do you? Hey, hey, that George Clooney always banging different broads. What a queer.
Starting point is 00:06:09 So closing a few corporate tax loopholes and returning the top marginal tax rate to the 90s economic boom time levels is class warfare. And if there's one thing the rich have learned, it's that class warfare is hell. He invoked the corporate jet class. So that's a whole new category of people to demonize, right? Soak the rich, it's their fault. Barack Obama's tax on these evil,
Starting point is 00:06:41 disgusting corporate jet owners. Demonizing the rich as evil, as lazy, as inheritors of their wealth. He's saying they're fat cats. It's disappointing. It's class warfare and it's the kind of language that you would expect from a leader of a third world country, not the president of the United States. True, because the United States of America is not a third world country by any measure, except perhaps income inequality, where we rank, da da da da da da da, worse than the Ivory Coast, worse than Cameroon, 64th!
Starting point is 00:07:15 Ah! In your face, Uruguay, Jamaica and Uganda! Uganda? Yeah. Uganda. Yeah. Uganda. Yeah. Keep trying, Rwanda. Wow. And by the way, not only is closing corporate loopholes...... You are a nerd crowd.
Starting point is 00:07:48 There's no doubt in my mind. ... By the way, not only is closing corporate loopholes and raising the marginal tax rate class warfare... ...it totally wouldn't even work. You can tax rich people all you want and you're not going to solve our problems. The idea that if we raise taxes, as the president said, on millionaires and billionaires, raise taxes on oil companies, raise taxes on owners of private jets, that that somehow is going to make a difference.
Starting point is 00:08:19 The president wants to raise the top two income tax rates, which would raise about $700 billion over 10 years. You know what? That's only a tiny fraction of the federal government's deficit. $700 billion over 10 years? Oh, my God. Wow. $700 billion?
Starting point is 00:08:37 That's less money than Warren Buffett's cleaning lady pulls out of his shower drain everywhere. So, Joe Miller, so seven hundred billion dollars of raised revenue over ten years ain't even worth the effort. I assume these folks have the same why bother attitude towards low level spending cuts. A national endowment for the arts, national endowment for the humanities, all those kind
Starting point is 00:09:09 of frivolous things, those should all be on the chopping block. Federal employees don't pay for parking, so if they just set up a parking for that, that'd get them $140 million. He doesn't have to waste your tax dollars and travel around in a $1.1 million luxury liner. Why are we spending $6 million? Why are we spending $1 million on the First Lady? You gotta start somewhere.
Starting point is 00:09:27 Even when we talk about NPR, $1 million here, that's a million dollars. Oh, so when you cut it, it's a million dollars. But when you tax it, it's, eh, $700 million. I mean, all we'd have to do to raise $700 billion is cut 700,000 NPRs. It's almost too easy. But if it's revenue you want, there
Starting point is 00:09:55 does happen to be another place instead of the rich that you can look for it. Warren Buffett writing how the rich should pay more taxes, but saying not a word about the half of American households that pay no income taxes at all. Is that fair when half the population pays absolutely nothing? 51% that's a majority of American households paid no income tax in 2009. Zero. Zip. Nada. Many of them get so much money in tax credits that it wipes out any social security taxes
Starting point is 00:10:29 or Medicare taxes they're paying. They are absolutely on a free ride. You hear that, Pores? The free ride is over. So it looks like you'll be walking to work, assuming you have a job. The ride is over. So it looks like you'll be walking to work, assuming you have a job. Chances are you probably don't have a job. So why are you asking us for a ride?
Starting point is 00:10:56 So the solution to our economic problem, the solution to our economic problem isn't taxing the rich. It's broaden the tax base. Everyone needs to pay something. Before you start demanding one group pay more, maybe get everyone to put skin in the game. That's the problem with poor people. They still have some of their skin. But you know what? Maybe they're right. Maybe Fox is right. Maybe the bottom 50% of Americans, while they already pay excise and payroll and Medicare taxes, do need to pay more. I mean, they can spare it. After all, they control 2.5% of our nation's wealth. Oh, you know what? Actually, this is a pretty easy calculation. We can do this. The bottom 50% is just simple math. In dollar figures, the bottom 50% of this country have $1.45 trillion in everything
Starting point is 00:11:52 they own on this earth. So let's see. They have $1.45 trillion. So what do you say we take, I don't know, half of that? That'd be, oh, look at this, $700 billion. Why does that figure sound so familiar? The president wants to raise the top two income tax rates which would raise about $700 billion over 10 years. You know what?
Starting point is 00:12:27 That's only a tiny fraction of the federal government's deficit. So raising the income tax rate on the top 2% of earners would raise $700 billion, but taking half of everything the bottom 50% have in this country would do the same. I see the problem here. We need to take all of what the bottom 50% have. All of it. It's the only way to make a significant dent. Now we're up to $1.4 trillion. And if you're worried about the poor's, don't.
Starting point is 00:12:59 Because they're defined by the census as a family of four making less than $22,350 a year. Four! $22,350 a year! They'll be fine! Poor families in the United States are not what they used to be. When you look at the actual living conditions of the 43 million people that the census says are poor, you see that in fact they have all these modern conveniences.
Starting point is 00:13:25 99% of them have a refrigerator. 99% have refrigerators. You food-chilling motherf*****s. How dare you. That's why it makes complete sense. That's why it makes complete sense. That's why it makes complete sense that the word poor in that graphic is in quotations. These people aren't poor, they're...
Starting point is 00:13:58 I'm sure the other 1% of those people who don't have refrigerators don't have them, not because they don't have food, because they're always ordering room service. These poor people are living like they just want a showcase showdown. 81% have a microwave. 78% have air conditioning. 63% have cable TV. 54% have cell phones.
Starting point is 00:14:20 48% have a coffee maker. 25% have a dishwasher. 25% have a dishwasher? 25% have a dishwasher? Although to be fair, after a 12 hour shift of washing dishes, the last thing you want is to bring your work home with you. So you see, the problem with increasing the marginal tax rate on the rich and closing some corporate tax loopholes isn't that it engages in class warfare, it's that it's fighting on the wrong side of the war.
Starting point is 00:14:46 It is all-out war on the productive class in our society for the benefit of the moocher class. The makers and the takers. They want to take it from somebody else. Everyone's jumping in the wagon. No one wants to pull. Parasites we have out there, dependent on government. The raccoons. They're not stupid. They're going to do the easy way if we make it easy for them,
Starting point is 00:15:07 just like welfare recipients all across America. Welfare will create generations of utterly irresponsible animals. Yeah. F*** those people. The poor. As we've just seen earlier, last night, Mitt Romney won big in Florida, cementing his front-runner status. And today, he's on to the morning shows for a quick little victory lap. And by the way, I'm in this race because I care about Americans.
Starting point is 00:15:39 I'm not concerned about the very poor. We have a safety net there. If it needs repair, I'll fix it. I'm not concerned about the very poor. We have a safety net there. If it needs repair, I'll fix it. I'm not concerned about the very rich. They're doing just fine. Zagatagatbagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagat the very poor because they're okay too. Because you know the reason the net is there is they're not okay. It's like a doctor going, you know, I'm not concerned about the very healthy
Starting point is 00:16:11 because they're doing fine. Or the very sick because, you know, morphine. You know what I'm saying? But you know what, maybe I heard it wrong. I could have heard it wrong, you know, obviously. Did that sound weird to anybody else? You just said, I'm not concerned about the very poor because they have a safety net.
Starting point is 00:16:27 And I think there are lots of very poor Americans who are struggling who would say, that sounds odd. Can you explain that? TV news person just heard what candidate said and then stopped him and made him spleen himself. Like a flower blooming in the desert. Quick, someone dig that up and get it away from CNN before one of their giant holographic monitors
Starting point is 00:16:59 falls and crushes it. Well, you had to finish the sentence, Soledad. I said, I'm not concerned about the very poor that have a safety net, but if it has holes in it, I will repair them. Right, but it's still a f***ing net! And here's the thing about being in a net. Being in a net is bad, whether you're a butterfly
Starting point is 00:17:16 or a fish or a trapeze artist or a poor person. If you're in a net, something has gone terribly, terribly wrong. But you know what? I'm sure Romney gets a chance to clarify his statements. He'll in no way reinforce his aristocratic patrician master of the universe-ishness. The challenge right now, we will hear from the Democrat party the plight of the poor and there's no question it's not good being poor. I mean, they've got to play tennis on public courts. Ride rental ponies when their butlers tuck them in at night.
Starting point is 00:17:55 I can only imagine the Fed count on their linens. My point is, we don't need to be concerned about it. For more on Mitt Romney's apparent conflation of the very rich and very poor as constituencies unneeding of attention, we're joined by Jason Jones and John Oliver. Very nice to see you guys. All right.
Starting point is 00:18:11 We're gonna start here. Team very poor, we're gonna start with you. Whoa, whoa, whoa, whoa, whoa, nice try there, Stuart. Okay, but we're gonna play a little class warfare experiment. Yeah, we're not gonna let. OK, but we're not going to play your little class warfare experiment. Yeah, we're not going to let you divide us. I'm not trying to divide you, but you both represent the two most extreme socioeconomic groups
Starting point is 00:18:32 in this country. No, don't try to pit the 1% against the equivalent 1%. Actually, I think your numbers might be off. It's your 1%, but this is actually larger. Very poor is like 7%. Poverty is like 15%. No, no, no, no, no, no. We're exactly the same. We're two peas in a pod.
Starting point is 00:18:50 Bugs in my bed. I say potato. And I say, do you actually have a potato? Because I could eat the hell out of a potato right now. I am massively hungry. But, but, but, but, but. So both of you are okay with Governor Romney saying that each of these constituencies can be ignored because they're doing okay. Of course, that's fine, but, but, so both of you are okay with Governor Romney saying that each
Starting point is 00:19:05 of these constituencies can be ignored because they're doing okay. Of course, that's fine. No problem. Absolutely, yes. I mean, I can take all my massive real estate holdings and defer the taxes through 1031 exchanges and minimize my IRS exposure through my Cayman Island subsidiaries and an almost sarcastic amount of trusts. So don't worry about me, I'm fine. Mm-hmm.
Starting point is 00:19:25 Mm-hmm. John? Well, I receive $12 per day from the government. So no worries about me. Pretty comfortable safety net. Twinsies! Right. You know what's funny is I have a net too. Well, it's more like a golden parachute, Pretty comfortable safety nets. Twinsies!
Starting point is 00:19:47 You know what's funny is I have a net too. Well, it's more like a golden parachute, but same idea. Sorry. Our life experiences are incredibly similar. Yeah, we both love to fish. That's true. Last week I went fishing for marlin down in Key West. Yeah, and just yesterday I was under a bridge in the East River trying to augment my protein intake. I caught a boot and a used condom. Yesterday, I was under a bridge in the East River trying to augment my protein intake. I... I caught a boot and a used condom.
Starting point is 00:20:10 Delicious. Uh... Well, we both like baseball. Yes, go sports! Um, we both love modern family. Yeah, who doesn't? And we're taxed at the same rate. Yep. Wait, what?
Starting point is 00:20:24 How the fuck is that possible? How does that even f***ing make sense? You have no idea how much money it costs to get that kind of stuff through. He is right there, to be fair. Right, but do you see no difference then in your circumstance? You don't see... No, you can't divide us with your class warfare, Stuart. Right. Hmm. Hmm.
Starting point is 00:20:47 I am rich. And I am poor. When we go home, we both walk through front doors. Mine is solid mahogany. I don't really have a door. It's true. It's a beaded curtain. I am poor. I don't really have a door. It's true, it's a beaded curtain. I am poor.
Starting point is 00:21:09 And I am rich. I like foie gras. I don't know what that is. So please don't be concerned about us. Cause we're both okay. Except for me, I'm not okay. He's fine, he's fine. I'm not okay at all. He'll be fine, he's got us all.
Starting point is 00:21:27 It is not the same. Jason Jones and John Oliver, we'll be right back. ["The New York Times"] ["The New York Times"] ["The New York Times"] Last week brought unexpected news from Wall Street. The Dow Jones Industrial Average hit a record high. And you know what that means.
Starting point is 00:21:52 The rich are even richer and need to find more ways to dispose of their money. Like this Wall Street executive went to France to buy a $4 dollar custom-built Ferrari. Pina Farina designed and made all of the engineering, so it was really what my dream was. They said, what is your dream? And once I told them, they scanned me, and then they put me in virtual reality, and they made sure that I would feel comfortable driving and reaching for the controls.
Starting point is 00:22:21 Unlike those skanky off-the-rack Ferraris, where's the steering wheel on this thing? A gearshift there? Somebody pull over. Ferrari, not fast enough? The Russian space program is so bankrupt, it's letting millionaires hitch rides on their rockets. The latest astrotourist, American Anush Ansari, who spent 11 days in orbit. Price? $20 million. Expensive? You bet. But it was the only way she could achieve her lifelong dream of flying over every single starving person on earth and yelling, hey, look at what I'm spending my money on! LAUGHTER AND APPLAUSE CHEERING AND APPLAUSE Looking for a cheaper rocket ride?
Starting point is 00:23:12 Richard Branson, the leathery mogul behind Virgin Airways, has started Virgin Galactic, which offers to shoot you and five friends up into the great beyond for the low, low price of of 1.7 million dollars. Afterwards, you'll even get whisked off for a vacation on Sir Richard's private Caribbean Island retreat. And for an extra million, you can spend that vacation without Richard Branson. If the lure of space is stronger than your earnings potential, you can always haul your
Starting point is 00:23:43 life savings to a Star Trek auction. Like this one at Christie's in New York, where at least one loser went home a loser. I was trying to get the captain's chair, but when it went for $53,000, I said, I'll go for the consoles instead. Sadly, the consoles also proved too costly, but for $800, the autographed pair of Captain Picard's Space Undies was his. But while most millionaires are looking for ways to spend what they have, New York Knicks
Starting point is 00:24:18 guard Stefan Marbury is out to keep inner-city kids from spending what they don't. He's developed a line of cheap sportswear. The most expensive item is the Starberry One, a basketball shoe that sells for $14.98. We're putting people in a situation where they can buy something that's affordable. Everybody wants to have that. I don't care who you are, everybody wants the deal. Not everybody, Stefan! You hear about the pots who just spent $4 million on a Ferrari?
Starting point is 00:24:51 John? Thank you very much, Lewis. Move back, everybody! 15 kids woke up, got out of bed, walked into the dark, and they never came back. I'm the director of Barbarian. A lot of people died in a lot of weird ways. We're not gonna find it in the news because the police covered everything well up. On August 8th.
Starting point is 00:25:17 No! No! This is where the story really starts. Weapons. ["Dark Side of the World"] where the story really starts. Weapons. So the Democrats are launching multiple investigations into Trump and the thing he's most worried about them getting is his tax returns. See, President Trump doesn't want them knowing
Starting point is 00:25:40 how much money he has or where the money has gone. And it turns out he isn't the only rich person having sleepless nights. Many real billionaires are also worried about the Democrats coming after their taxes too. Senator Elizabeth Warren wants a new tax on the richest Americans. She's calling it the ultra millionaire tax.
Starting point is 00:25:56 It would impose a 2% tax on Americans whose net worth exceeds 50 million bucks with an additional 1% levy on billionaires. And newly elected Congresswoman Alexandria Ocasio-Cortez proposed marginal tax rates as high as 70% to fund a climate change plan called the Green New Deal. A growing number of Americans, 76%, support making the super rich,
Starting point is 00:26:20 I'm not talking about the average rich, the super rich, pay more in taxes. So Elizabeth Warren and Ocasio-Cortez are coming for the super rich, which by the way, sounds like the most useless superhero ever. Help me, super rich, that speeding bus is headed right for my kid.
Starting point is 00:26:39 Don't worry, I'll buy you a new kid. Super rich buys the day. Now a lot of people try and paint Elizabeth Warren and Ocasio-Cortez as these fringe socialists. But the truth is, 76% of Americans supporting the raising of taxes means it's not that fringe. That's a really impressive number, because usually the only thing 76% of Americans agree on
Starting point is 00:27:01 is that extra guac should be free. Yeah, and it should be. Guacamole is a human right. But it really shouldn't come as a surprise that people want to tax the super wealthy, especially since we've been hearing so much about how well they're doing. Around the world, billionaire wealth enjoyed
Starting point is 00:27:17 its greatest ever increase in 2017. The total wealth of global billionaires grew to $8.9 trillion. Just 26 people now control as much wealth as half of the Earth's population. The three wealthiest people in the United States, Bill Gates, Jeff Bezos, and Warren Buffett now own more wealth than the entire bottom half of the American population, combined a total of 163 million people or 63 million households. Holy shit.
Starting point is 00:27:47 Three dudes have as much money as the poorest 163 million people in America. Honestly, do we even have to tell them that we're taxing them? Like, cause I don't even think they'd notice. They'd just be like, yeah, just take it, just take it. And be like, well, what are you talking about? What taxes, what are you talking about?
Starting point is 00:28:05 They wouldn't notice, it's like if you took one tattoo away from Adam Levine, he's never gonna know. So because most of the world's wealth is becoming more and more concentrated, most people are on board with raising taxes on the super rich. Although, if you asked the super rich, they've got a billion reasons
Starting point is 00:28:24 why their taxes shouldn't go up. What do you think of Senator Warren's idea of a tax on wealth? We shouldn't be embarrassed about our system. If you want to look at a system that's non-capitalistic, just take a look at what was perhaps the wealthiest country in the world, and today people are starving to death.
Starting point is 00:28:43 It's called Venezuela. If the Democrats are proposing anything close to a 70% level of income tax, how many core Democrats are going to be supportive of a move towards socialism? Not very many. President Trump will get reelected. You don't have to be a genius to see what's happening here.
Starting point is 00:29:04 These billionaires are fear- mongering, right? They're making it seem like there are only two options in life. Either they have low taxes or we starve to death in Trumpazuela. And it's bullshit though, it is. Right, there's a middle ground. These, like this is the same logic that guys use
Starting point is 00:29:20 to get their girlfriends to have sex. It's like, either we bone or my balls are gonna explode, okay? It's called blue balls, it's really painful. Why don't you just check off? It's not the same. It is the same, just let it out.
Starting point is 00:29:33 There's a middle ground. For more on this, we turn to a man with two calculator apps on his phone, Ronnie Chang, everybody. Thank you. Thank you. Ronnie, as someone who's deep in the finance, what do you think about this new drive
Starting point is 00:29:47 to raise taxes on the rich? I'll be honest, Trevor. I used to support it, but then I became a crazy rich Asian. And now that I've made some money, I realize there is no difference between passing taxes on the rich and 9-11. Both attack American values, and both were done by the federal government.
Starting point is 00:30:06 I've told you, don't bring your conspiracy theories to the Daily Show, all right? Keep them on YouTube. Anyway, I'm shocked, Ronnie, that you're against taxing the super rich. Why would you be against that? Okay, let me explain something to you, Trevor, okay? When you don't have money, you think small.
Starting point is 00:30:22 You start believing we need taxes to pay for better schools or roads or healthcare for a better society. But once you have money, you see the bigger picture, which is that flying in private jets is fucking awesome. All right? So let's quit hating successful people. Trevor, not only should rich people pay less taxes,
Starting point is 00:30:41 but billionaires should pay none. Whoa, no taxes for billionaires? Why would you say this, dude? You're not even a billionaire. No, you're not a billionaire, right? But I will be as soon as my new product idea takes off, okay? Get this, it's a refrigerator that screams when it's empty. Ronny, that is a terrible idea.
Starting point is 00:31:02 You're such a jealous bitch, all right? Here's my point, America. These socialist haters are just trying to trap us, okay? They're gonna trick us into raising taxes on billionaires, but then once we all become billionaires, we'll be the ones getting screwed. Ronnie, you see, that's the trap. Billionaires act like with enough hard work,
Starting point is 00:31:18 anyone can become super rich, but the odds are insanely small. Like, there's only 3,000 billionaires in the entire world. Correction, Trevor, it's gonna be 3,001 after my Shrieko freeze. 5,000 hits the market. The slogan is, I scream, you scream, we all scream when there's no ice cream.
Starting point is 00:31:35 ["The New York Times"] Australia, the country named after the 2008 Hugh Jackman film, Australia. Uh, it's where one billionaire is learning that money can't buy you respect. An Australian billionaire is apparently not too happy with a portrait of herself that's on public display. That is Australia's richest woman, Gina Reinhart.
Starting point is 00:31:59 She is one of 21 people featured in the Australia in Color exhibit that's been on display since March at the National Gallery of Australia. It's reported Reinhart is demanding 21 people featured in the Australia in Color exhibit that's been on display since March at the National Gallery of Australia. It's reported Reinhart is demanding that the gallery remove the portrait. Wait, wait, wait, wait, remove the portrait?
Starting point is 00:32:12 What's the matter? You don't want people to know you testified at Donald Trump's trial? But anyway, what's the big deal with having an unflattering painting of you? You don't see any of Picasso's models complaining that their eye is on their forehead. Suck it up, lady.
Starting point is 00:32:27 Even if you don't like it, don't whine about it. Whining is what the rest of us do. Whining is free. You have money. Just pay another artist to paint a flattering portrait of you. Then buy the museum and hang your portrait over the other portrait.
Starting point is 00:32:44 Then burn the whole museum down for the insurance money and you end up making a profit. Billionaire shit. Let's go. But this story, yeah, I mean, use your head. But this story is really the proof that maybe billionaires aren't as smart as we all think they are. You know, if this woman hadn't complained about this painting practically nobody would have ever seen it.
Starting point is 00:33:08 I never would have heard of Gina Reinhart or Australia for that matter. Animals with pockets who thinks of this stuff. universe by searching The Daily Show, wherever you get your podcasts. Watch The Daily Show weeknights at 11, 10 Central on Comedy Central and stream full episodes anytime on Paramount Plus. This has been a Comedy Central podcast.

There aren't comments yet for this episode. Click on any sentence in the transcript to leave a comment.