The Daily Show: Ears Edition - TDS Time Machine | Billionaires
Episode Date: July 26, 2025Billionaires... they're just like us. Give or take a billion dollars. Join The Daily Show in exploring the ups and downs of the lives of the very rich. Jason Jones meets with psychologists helping p...eople cope with Sudden Wealth Syndrome. Jon Stewart talks about how attempts to close the wealth gap are vilified as class warfare. Jon pits the Very Rich against the Very Poor with help from John Oliver and Jason Jones. Lewis Black looks into the stupid stuff the rich spend their money on. Trevor Noah and Ronny Chieng dig into tax evasion strategies, and Michael Kosta unpacks the plight of an Australian billionaire who doesn't like her portrait. Learn more about your ad choices. Visit podcastchoices.com/adchoices
Transcript
Discussion (0)
You're listening to Comedy Central.
There's a great deal of talk in this country about people picking themselves up by their bootstraps to better their lives and fight their way into the 1%.
But is it worth the climb?
Jason Jones has more.
Amongst all the terrible news
about people who've lost their jobs or their homes,
there's been one group that's been overlooked,
the extremely wealthy.
Luckily, psychologist Dr. Steven Goldberg
and psychotherapist Joan DeFuria have been there to help.
Well, an average client is 25 to 50 million and up.
Generally, people come to us who do not have to work
another day in their lives.
So why do they have problems?
I know it sounds very odd.
Yes.
But the climate today is very different
than it was 10 years ago.
We're really angry at the haves right now.
And so what happens because of that is the wealthy
end up hiding themselves in these gated communities.
When I think about these people I just feel bad and I just want to punch them in the f***ing face.
The wealthy are people too.
From the trust belt in Connecticut to the tech ghettos of Silicon Valley, the rich are being unfairly vilified.
But DeFuria and Goldberg's research at their Money, Meaning and Choices Institute slash website
has identified an even more serious problem.
We coined the phrase sudden wealth syndrome.
Sudden wealth syndrome.
SWS.
To describe the psychological issues and symptoms
that many people experience as a consequence of coming into new or sudden wealth.
They have problems.
And that's why we coined the term SWS.
If you contracted SWS, could that ever lead to full blown
RBS what's that
restless Butler syndrome.
We're not going to buy on that date next question, I'm sorry
I'm sorry making up a condition in giving it an acronym to make
it sound more legitimate is pretty foolish.
Sure the poor in the middle class are worried about having enough food, but the wealthy have to worry about whether or not their waiter is recording them while they mock half the
country.
It's a painful reality that afflicts at least 1% of the 1%.
So let's say I've created a hot new app.
Right.
It's called DickWidget.
Okay. Now I'm worth $idget. Yeah. Okay.
Now I'm worth $100 million.
Can you help me?
Well, we begin by asking you what...
DickWidget is, yes.
Well, no, I don't really care what DickWidget is.
Well, no, DickWidget is an app
that draws on people's faces.
So it doesn't really matter how you made your money
or what, you got it.
You got lucky?
Well, not really.
DickWidget was very popular.
Yeah, but we don't really know
what the details of your business.
We really need to understand why it is you're coming to us.
I don't know. You tell me. You're the shrinks.
What are the needs and wants that you have that have nothing to do with your pocketbook anymore?
For example, if I gave you this briefcase, and it was filled with millions of dollars,
and you, Jason, you got it.
All right. You feel pretty damn good right now.
You feel pretty good right now, and then what's going to happen?
What are you going to do with your life?
I don't know. Coke, hookers, witness.
So this is what we call the honey moon phase of getting money. Okay. You've done that for a while, and then what's gonna happen? What are you gonna do with your life? I don't know, coke, hookers, what else? So this is what we call the honey moon phase
of getting money.
Okay.
Done that for a while, and then what's gonna happen?
More coke, more hookers.
Most people find after six months or a year,
and they say, well now what?
We're all gonna die, so in between the time
between now and when we die, what do we fill our time with?
Get down to business, open a nightclub called Double J's.
And then what would you do?
Start a basketball league on jet skis.
Let me get happy.
Yes, I do not see a bad outcome here.
But only after walking a mile in a rich person's $4,000 fair
agamos did I truly know the paralyzing anxiety of sudden
wealth.
We are pleased. Thank you very much.
It's table salt.
Yeah, I did it and as the developer of the revolutionary
app Dick widget and creator of the world's most popular sport.
I was glad I had mental health professionals like the fury and
Goldberg to help me confront my demons.
You're now a rich guy you're like dozens and dozens of
people here in Silicon Valley and all of a sudden no longer
Jason the computer program.
It's coming out your cheek.
Thank you doctor Goldberg feeling better already.
better already. There is an ongoing argument in this very country about how best to close the enormous
deficit that we have incurred.
The Republicans have proposed doing it entirely through spending cuts, whereas the Democrats have bravely fought back, insisting we do it almost entirely through spending cuts.
Well, this week, bizarrely,
un-eccentric billionaire Warren Buffett...
entered the fray.
The billionaire says,
While most Americans struggle to make ends meet,
we mega- rich continue to
get our extraordinary tax breaks. My friends and I have been coddled long
enough. I pay a lower tax rate on much of my income than my cleaning lady does.
Well to be fair, Warren Buffett's cleaning lady is also a billionaire.
Warren Buffett's op-ed was a thoughtful treatise on the advantages the super-wealthy currently
enjoy at the hands of the tax code.
Or to put that another way.
Up next tonight, Warren Buffett's class warfare.
More class warfare from an affable billionaire who should stop assuming the rich are all
billionaires.
Warren Buffett wrote an op-ed. Is he completely a socialist?
Is Warren Buffett a socialist?
You really have no f***ing clue what socialism is, do you?
Hey, hey, that George Clooney always banging different broads.
What a queer.
So closing a few corporate tax loopholes and returning the top marginal tax rate to the
90s economic boom time levels is class warfare.
And if there's one thing the rich have learned,
it's that class warfare is hell.
He invoked the corporate jet class.
So that's a whole new category of people to demonize, right?
Soak the rich, it's their fault.
Barack Obama's tax on these evil,
disgusting corporate jet owners.
Demonizing the rich as evil, as lazy, as inheritors of their wealth.
He's saying they're fat cats.
It's disappointing. It's class warfare and it's the kind of language that you would expect
from a leader of a third world country, not the president of the United States.
True, because the United States of America is not a third world country by any measure, except perhaps
income inequality, where we rank, da da da da da da da, worse than the Ivory Coast,
worse than Cameroon, 64th!
Ah!
In your face, Uruguay, Jamaica and Uganda!
Uganda?
Yeah.
Uganda. Yeah. Uganda. Yeah.
Keep trying, Rwanda.
Wow. And by the way, not only is closing corporate loopholes......
You are a nerd crowd.
There's no doubt in my mind.
...
By the way, not only is closing corporate loopholes and raising the marginal tax rate class warfare...
...it totally wouldn't even work.
You can tax rich people all you want and you're not going to solve our problems.
The idea that if we raise taxes, as the president said, on millionaires and billionaires, raise
taxes on oil companies, raise taxes on owners of private jets, that that somehow is going
to make a difference.
The president wants to raise the top two income tax rates, which would raise about $700 billion
over 10 years.
You know what? That's only a tiny fraction
of the federal government's deficit.
$700 billion over 10 years?
Oh, my God.
Wow.
$700 billion?
That's less money than Warren Buffett's cleaning lady
pulls out of his shower drain everywhere.
So, Joe Miller,
so seven hundred billion dollars of raised revenue over ten years ain't even
worth the effort.
I assume these folks
have the same why bother attitude towards low level spending cuts.
A national endowment for the arts, national endowment for the humanities, all those kind
of frivolous things, those should all be on the chopping block.
Federal employees don't pay for parking, so if they just set up a parking for that, that'd
get them $140 million.
He doesn't have to waste your tax dollars and travel around in a $1.1 million luxury
liner.
Why are we spending $6 million?
Why are we spending $1 million on the First Lady?
You gotta start somewhere.
Even when we talk about NPR, $1 million here,
that's a million dollars.
Oh, so when you cut it, it's a million dollars.
But when you tax it, it's, eh, $700 million.
I mean, all we'd have to do to raise $700 billion
is cut 700,000 NPRs.
It's almost too easy.
But if it's revenue you want, there
does happen to be another place instead of the rich
that you can look for it.
Warren Buffett writing how the rich should pay more taxes,
but saying not a word about the half of American households that pay no income taxes at
all. Is that fair when half the population pays absolutely nothing?
51% that's a majority of American households paid no income tax in 2009.
Zero. Zip. Nada. Many of them get so much money in tax credits
that it wipes out any social security taxes
or Medicare taxes they're paying.
They are absolutely on a free ride.
You hear that, Pores?
The free ride is over.
So it looks like you'll be walking to work, assuming you have a job. The ride is over.
So it looks like you'll be walking to work, assuming you have a job.
Chances are you probably don't have a job.
So why are you asking us for a ride?
So the solution to our economic problem, the solution to our economic problem isn't taxing the rich.
It's broaden the tax base. Everyone needs to pay something. Before you start
demanding one group pay more, maybe get everyone to put skin in the game. That's
the problem with poor people. They still have some of their skin. But you know
what? Maybe they're right. Maybe Fox is right. Maybe the bottom 50% of Americans,
while they already pay excise and payroll and Medicare taxes, do need to pay more. I
mean, they can spare it. After all, they control 2.5% of our nation's wealth. Oh, you know
what? Actually, this is a pretty easy calculation. We can do this. The bottom 50% is just simple math. In dollar figures, the bottom 50% of this country have $1.45 trillion in everything
they own on this earth.
So let's see.
They have $1.45 trillion.
So what do you say we take, I don't know, half of that?
That'd be, oh, look at this, $700 billion.
Why does that figure sound so familiar? The president wants to raise the top two
income tax rates which would raise about $700 billion over 10 years.
You know what?
That's only a tiny fraction of the federal government's deficit.
So raising the income tax rate on the top 2% of earners would raise $700 billion,
but taking half of everything the bottom 50% have in this country would do the same.
I see the problem here. We need to take all of what the bottom 50% have.
All of it.
It's the only way to make a significant dent.
Now we're up to $1.4 trillion.
And if you're worried about the poor's, don't.
Because they're defined by the census as a family of four
making less than $22,350 a year.
Four!
$22,350 a year!
They'll be fine!
Poor families in the United States are not what they used to be.
When you look at the actual living conditions of the 43 million people that the census says
are poor, you see that in fact they have all these modern conveniences.
99% of them have a refrigerator.
99% have refrigerators.
You food-chilling motherf*****s.
How dare you.
That's why it makes complete sense. That's why it makes complete sense.
That's why it makes complete sense that the word
poor in that graphic is in quotations.
These people aren't poor, they're...
I'm sure the other 1% of those people who don't have refrigerators
don't have them, not because they don't have food,
because they're always ordering room service.
These poor people are living like they just want a showcase showdown.
81% have a microwave.
78% have air conditioning.
63% have cable TV.
54% have cell phones.
48% have a coffee maker.
25% have a dishwasher.
25% have a dishwasher? 25% have a dishwasher?
Although to be fair, after a 12 hour shift of washing dishes,
the last thing you want is to bring your work home with you.
So you see, the problem with increasing the marginal tax rate on the rich
and closing some corporate tax loopholes isn't that it engages in class warfare,
it's that it's fighting on the wrong side of the war.
It is all-out war on the productive class in our society
for the benefit of the moocher class.
The makers and the takers.
They want to take it from somebody else.
Everyone's jumping in the wagon. No one wants to pull.
Parasites we have out there, dependent on government.
The raccoons. They're not stupid.
They're going to do the easy way if we make it easy for them,
just like welfare recipients all across America.
Welfare will create generations of utterly irresponsible animals.
Yeah.
F*** those people.
The poor. As we've just seen earlier, last night, Mitt Romney won big in Florida, cementing his front-runner
status.
And today, he's on to the morning shows for a quick little victory lap.
And by the way, I'm in this race because I care about Americans.
I'm not concerned about the very poor.
We have a safety net there.
If it needs repair, I'll fix it.
I'm not concerned about the very poor. We have a safety net there. If it needs repair, I'll fix it. I'm not concerned about the very rich.
They're doing just fine. Zagatagatbagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagat the very poor because they're okay too. Because you know the reason the net is there
is they're not okay.
It's like a doctor going, you know,
I'm not concerned about the very healthy
because they're doing fine.
Or the very sick because, you know, morphine.
You know what I'm saying?
But you know what, maybe I heard it wrong.
I could have heard it wrong, you know, obviously.
Did that sound weird to anybody else?
You just said, I'm not concerned about the very poor
because they have a safety net.
And I think there are lots of very poor Americans
who are struggling who would say, that sounds odd.
Can you explain that?
TV news person just heard what candidate said
and then stopped him and made him spleen himself.
Like a flower blooming in the desert.
Quick, someone dig that up and get it away from CNN
before one of their giant holographic monitors
falls and crushes it.
Well, you had to finish the sentence, Soledad.
I said, I'm not concerned about the very poor
that have a safety net, but if it has holes in it,
I will repair them.
Right, but it's still a f***ing net!
And here's the thing about being in a net.
Being in a net is bad, whether you're a butterfly
or a fish or a trapeze artist or a poor person.
If you're in a net, something has gone terribly, terribly wrong.
But you know what? I'm sure Romney gets a chance to clarify his statements. He'll in
no way reinforce his aristocratic patrician master of the universe-ishness.
The challenge right now, we will hear from the Democrat party the plight of the poor
and there's no question it's not good being poor.
I mean, they've got to play tennis on public courts.
Ride rental ponies when their butlers tuck them in at night.
I can only imagine the Fed count on their linens.
My point is, we don't need to be concerned about it.
For more on Mitt Romney's apparent conflation
of the very rich and very poor
as constituencies unneeding of attention,
we're joined by Jason Jones and John Oliver.
Very nice to see you guys.
All right.
We're gonna start here.
Team very poor, we're gonna start with you.
Whoa, whoa, whoa, whoa, whoa, nice try there, Stuart.
Okay, but we're gonna play a little
class warfare experiment. Yeah, we're not gonna let. OK, but we're not going to play your little class warfare experiment.
Yeah, we're not going to let you divide us.
I'm not trying to divide you, but you both represent
the two most extreme socioeconomic groups
in this country.
No, don't try to pit the 1% against the equivalent 1%.
Actually, I think your numbers might be off.
It's your 1%, but this is actually larger.
Very poor is like 7%. Poverty is like 15%.
No, no, no, no, no, no.
We're exactly the same.
We're two peas in a pod.
Bugs in my bed.
I say potato.
And I say, do you actually have a potato?
Because I could eat the hell out of a potato right now.
I am massively hungry.
But, but, but, but, but.
So both of you are okay with Governor Romney
saying that each of these constituencies can be ignored because they're doing okay. Of course, that's fine, but, but, so both of you are okay with Governor Romney saying that each
of these constituencies can be ignored because they're doing okay.
Of course, that's fine.
No problem.
Absolutely, yes.
I mean, I can take all my massive real estate holdings and defer the taxes through 1031
exchanges and minimize my IRS exposure through my Cayman Island subsidiaries and an almost
sarcastic amount of trusts.
So don't worry about me, I'm fine. Mm-hmm.
Mm-hmm.
John?
Well, I receive $12 per day from the government.
So no worries about me.
Pretty comfortable safety net.
Twinsies!
Right.
You know what's funny is I have a net too. Well, it's more like a golden parachute, Pretty comfortable safety nets. Twinsies!
You know what's funny is I have a net too.
Well, it's more like a golden parachute, but same idea. Sorry.
Our life experiences are incredibly similar.
Yeah, we both love to fish.
That's true. Last week I went fishing for marlin down in Key West.
Yeah, and just yesterday I was under a bridge in the East River trying to augment my protein intake.
I caught a boot and a used condom. Yesterday, I was under a bridge in the East River trying to augment my protein intake. I...
I caught a boot and a used condom.
Delicious.
Uh...
Well, we both like baseball.
Yes, go sports!
Um, we both love modern family.
Yeah, who doesn't?
And we're taxed at the same rate.
Yep. Wait, what?
How the fuck is that possible?
How does that even f***ing make sense? You have no idea how much money it costs to get that kind of stuff through.
He is right there, to be fair.
Right, but do you see no difference then in your circumstance?
You don't see...
No, you can't divide us with your class warfare, Stuart. Right.
Hmm.
Hmm.
I am rich.
And I am poor.
When we go home, we both walk through front doors.
Mine is solid mahogany.
I don't really have a door.
It's true. It's a beaded curtain. I am poor. I don't really have a door.
It's true, it's a beaded curtain.
I am poor.
And I am rich.
I like foie gras.
I don't know what that is.
So please don't be concerned about us.
Cause we're both okay.
Except for me, I'm not okay. He's fine, he's fine.
I'm not okay at all.
He'll be fine, he's got us all.
It is not the same.
Jason Jones and John Oliver, we'll be right back.
["The New York Times"]
["The New York Times"]
["The New York Times"]
Last week brought unexpected news from Wall Street.
The Dow Jones Industrial Average hit a record high.
And you know what that means.
The rich are even richer and need to find more ways to dispose of their money.
Like this Wall Street executive went to France to buy a $4 dollar custom-built Ferrari. Pina Farina designed and made all of the engineering,
so it was really what my dream was.
They said, what is your dream?
And once I told them, they scanned me,
and then they put me in virtual reality,
and they made sure that I would feel comfortable driving
and reaching for the controls.
Unlike those skanky off-the-rack Ferraris, where's the steering wheel on this
thing? A gearshift there? Somebody pull over. Ferrari, not fast enough? The Russian space
program is so bankrupt, it's letting millionaires hitch rides on their rockets. The latest astrotourist, American Anush Ansari, who spent 11 days in orbit.
Price? $20 million. Expensive? You bet. But it was the only way she could achieve her
lifelong dream of flying over every single starving person on earth and yelling, hey,
look at what I'm spending my money on! LAUGHTER AND APPLAUSE
CHEERING AND APPLAUSE
Looking for a cheaper rocket ride?
Richard Branson, the leathery mogul behind Virgin Airways,
has started Virgin Galactic, which offers to shoot you
and five friends up into the great beyond
for the low, low price of of 1.7 million dollars.
Afterwards, you'll even get whisked off for a vacation on Sir Richard's private Caribbean
Island retreat.
And for an extra million, you can spend that vacation without Richard Branson.
If the lure of space is stronger than your earnings potential, you can always haul your
life savings to a
Star Trek auction. Like this one at Christie's in New York, where at least one loser went
home a loser.
I was trying to get the captain's chair, but when it went for $53,000, I said, I'll go
for the consoles instead.
Sadly, the consoles also proved too costly, but for $800, the autographed pair of Captain
Picard's Space Undies was his.
But while most millionaires are looking for ways to spend what they have, New York Knicks
guard Stefan Marbury is out to keep inner-city kids from spending what they don't.
He's developed a line of cheap sportswear.
The most expensive item is the Starberry One, a basketball shoe that sells for $14.98.
We're putting people in a situation where they can buy something that's affordable.
Everybody wants to have that.
I don't care who you are, everybody wants the deal.
Not everybody, Stefan!
You hear about the pots who just spent $4 million on a Ferrari?
John?
Thank you very much, Lewis.
Move back, everybody! 15 kids woke up, got out of bed, walked into the dark, and they never came back.
I'm the director of Barbarian.
A lot of people died in a lot of weird ways.
We're not gonna find it in the news
because the police covered everything well up.
On August 8th.
No!
No!
This is where the story really starts.
Weapons.
["Dark Side of the World"] where the story really starts. Weapons. So the Democrats are launching multiple investigations
into Trump and the thing he's most worried about them getting
is his tax returns.
See, President Trump doesn't want them knowing
how much money he has or where the money has gone.
And it turns out he isn't the only rich person
having sleepless nights.
Many real billionaires are also worried
about the Democrats coming after their taxes too.
Senator Elizabeth Warren wants a new tax
on the richest Americans.
She's calling it the ultra millionaire tax.
It would impose a 2% tax on Americans
whose net worth exceeds 50 million bucks
with an additional 1% levy on billionaires.
And newly elected Congresswoman Alexandria Ocasio-Cortez
proposed marginal tax rates as high as 70%
to fund a climate change plan called the Green New Deal.
A growing number of Americans, 76%,
support making the super rich,
I'm not talking about the average rich,
the super rich, pay more in taxes.
So Elizabeth Warren and Ocasio-Cortez
are coming for the super rich,
which by the way,
sounds like the most useless superhero ever.
Help me, super rich,
that speeding bus is headed right for my kid.
Don't worry, I'll buy you a new kid.
Super rich buys the day.
Now a lot of people try and paint Elizabeth Warren
and Ocasio-Cortez as these fringe socialists.
But the truth is, 76% of Americans
supporting the raising of taxes means it's not that fringe.
That's a really impressive number,
because usually the only thing 76% of Americans agree on
is that extra guac should be free.
Yeah, and it should be.
Guacamole is a human right.
But it really shouldn't come as a surprise
that people want to tax the super wealthy,
especially since we've been hearing so much
about how well they're doing.
Around the world, billionaire wealth enjoyed
its greatest ever increase in 2017.
The total wealth of global billionaires
grew to $8.9 trillion.
Just 26 people now control as much wealth as half of the Earth's population.
The three wealthiest people in the United States, Bill Gates, Jeff Bezos, and Warren
Buffett now own more wealth than the entire bottom half of the American population, combined
a total of 163 million people or 63 million households.
Holy shit.
Three dudes have as much money
as the poorest 163 million people in America.
Honestly, do we even have to tell them
that we're taxing them?
Like, cause I don't even think they'd notice.
They'd just be like, yeah, just take it, just take it.
And be like, well, what are you talking about?
What taxes, what are you talking about?
They wouldn't notice, it's like if you took one tattoo
away from Adam Levine, he's never gonna know.
So because most of the world's wealth
is becoming more and more concentrated,
most people are on board with raising taxes
on the super rich.
Although, if you asked the super rich,
they've got a billion reasons
why their taxes shouldn't go up.
What do you think of Senator Warren's idea
of a tax on wealth?
We shouldn't be embarrassed about our system.
If you want to look at a system that's non-capitalistic,
just take a look at what was perhaps
the wealthiest country in the world,
and today people are starving to death.
It's called Venezuela.
If the Democrats are proposing anything close
to a 70% level of income tax,
how many core Democrats are going to be supportive
of a move towards socialism?
Not very many.
President Trump will get reelected.
You don't have to be a genius to see what's happening here.
These billionaires are fear- mongering, right?
They're making it seem like
there are only two options in life.
Either they have low taxes
or we starve to death in Trumpazuela.
And it's bullshit though, it is.
Right, there's a middle ground.
These, like this is the same logic that guys use
to get their girlfriends to have sex.
It's like, either we bone
or my balls are gonna explode,
okay?
It's called blue balls, it's really painful.
Why don't you just check off?
It's not the same.
It is the same, just let it out.
There's a middle ground.
For more on this, we turn to a man
with two calculator apps on his phone,
Ronnie Chang, everybody.
Thank you.
Thank you.
Ronnie, as someone who's deep in the finance,
what do you think about this new drive
to raise taxes on the rich?
I'll be honest, Trevor.
I used to support it, but then I became a crazy rich Asian.
And now that I've made some money,
I realize there is no difference
between passing taxes on the rich and 9-11.
Both attack American values,
and both were done by the federal government.
I've told you, don't bring your conspiracy theories
to the Daily Show, all right?
Keep them on YouTube.
Anyway, I'm shocked, Ronnie,
that you're against taxing the super rich.
Why would you be against that?
Okay, let me explain something to you, Trevor, okay?
When you don't have money, you think small.
You start believing we need taxes
to pay for better schools
or roads or healthcare for a better society.
But once you have money, you see the bigger picture,
which is that flying in private jets is fucking awesome.
All right?
So let's quit hating successful people.
Trevor, not only should rich people pay less taxes,
but billionaires should pay none.
Whoa, no taxes for billionaires?
Why would you say this, dude?
You're not even a billionaire.
No, you're not a billionaire, right?
But I will be as soon as my new product idea takes off, okay?
Get this, it's a refrigerator that screams when it's empty.
Ronny, that is a terrible idea.
You're such a jealous bitch, all right?
Here's my point, America.
These socialist haters are just trying to trap us, okay?
They're gonna trick us into raising taxes on billionaires,
but then once we all become billionaires,
we'll be the ones getting screwed.
Ronnie, you see, that's the trap.
Billionaires act like with enough hard work,
anyone can become super rich,
but the odds are insanely small.
Like, there's only 3,000 billionaires in the entire world.
Correction, Trevor, it's gonna be 3,001
after my Shrieko freeze.
5,000 hits the market.
The slogan is, I scream, you scream,
we all scream when there's no ice cream.
["The New York Times"]
Australia, the country named after the 2008
Hugh Jackman film, Australia.
Uh, it's where one billionaire is learning
that money can't buy you respect.
An Australian billionaire is apparently not too happy
with a portrait of herself that's on public display.
That is Australia's richest woman, Gina Reinhart.
She is one of 21 people featured
in the Australia in Color exhibit
that's been on display since March
at the National Gallery of Australia. It's reported Reinhart is demanding 21 people featured in the Australia in Color exhibit that's been on display since March
at the National Gallery of Australia.
It's reported Reinhart is demanding
that the gallery remove the portrait.
Wait, wait, wait, wait, remove the portrait?
What's the matter?
You don't want people to know you testified
at Donald Trump's trial?
But anyway, what's the big deal
with having an unflattering painting of you?
You don't see any of Picasso's models complaining
that their eye is on their forehead.
Suck it up, lady.
Even if you don't like it, don't whine about it.
Whining is what the rest of us do.
Whining is free.
You have money.
Just pay another artist to paint a flattering portrait
of you.
Then buy the museum and hang your portrait
over the other portrait.
Then burn the whole museum down for the insurance money and you end up making a profit.
Billionaire shit.
Let's go.
But this story, yeah, I mean, use your head.
But this story is really the proof that maybe billionaires aren't as smart as we all think
they are.
You know, if this woman hadn't complained about this
painting practically nobody would have ever seen it.
I never would have heard of Gina Reinhart or Australia for
that matter.
Animals with pockets who thinks of this stuff. universe by searching The Daily Show, wherever you get your podcasts. Watch The Daily Show weeknights at 11, 10 Central on Comedy Central and
stream full episodes anytime on Paramount Plus.
This has been a Comedy Central podcast.