The Moth - The Moth Radio Hour: I Will Be Your Father Figure

Episode Date: June 20, 2023

In this special episode of The Moth, we listen to five stories about fathers — from embarrassing jokes to tender moments shared on the road. The Moth’s Executive Producer, Sarah Austin Jenness, also interviews the fathers in her own family. The Moth Radio Hour is produced by The Moth and Jay Allison of Atlantic Public Media Storytellers: Adrianne McGillis’ father's favorite joke lands him in the hospital. CJ Hunt reflects on mix-tapes and memories from his past. Blessing Digha fears she has fallen short of her father’s expectations. Lauren Thurman navigates life with her many iterations of dads. Harwood Taylor reaches for a father who is out of touch.

Attention Houston! You have listened to our podcast and our radio hour, but did you know the Moth has live storytelling events at Wearhouse Live? The Moth has opened Mike's storytelling competitions called Story Slams that are open to anyone with a five-minute story to share on the night's theme. Upcoming themes include love hurts, stakes, clean, and pride. GoodLamoth.org forward slash Houston to experience a live show near you. That's from Purex. This is the Moth Radio Hour. I'm Sarah Austin-Geness and this episode is all about dads and the impact that father figures have. I'm Sarah Austin-Geness and this episode is all about dads and the impact that father figures have. I'm Sarah Austin-Geness and this episode is all about dads and the impact that father figures have.

We emulate them, compete with them, want to differentiate ourselves from them, it's complicated. Some of us want to make our fathers proud, and we'll even hear a little bit from my dad. Dad, do you have a favorite child? No. My first and my last. Are both special to me. I should note that my father has only two children.

We'll save the rest of that interview for later in the Sour. Our first story is about dad jokes. I don't mean jokes about our dads. I mean the groaners, the corny humor that makes dads laugh. And note to the listeners, the joke in this story may be racy for a third grader. So there you go, we'd like to let you know these things in advance. Adrienne McGillis told us at one of our open-mic slams in Asheville, North Carolina, where we partner with Public Radio Station WCQS.

Here's Adrienne live at the mall. So this is a story about a joke so bad that it was in fact quite dangerous. So my dad loves a good punchline and when I was about 12 and my brother was 8 we were sitting around the kitchen table telling like fourth grade level jokes and all of a sudden my brother was eight, we were sitting around the kitchen table telling like fourth grade level jokes. And all of a sudden my brother perked up because he had this really great joke he was going to tell. And he said, well, I need a pad of paper.

And so my mom got him a piece of paper out of the kitchen junk drawer and a pencil. He hunched over and started drawing. And my dad watched this with interest. And my brother spun the paper around. And my dad peered at it. And if you could imagine like an eighth grade are drawing two stick figures with their hands sticking straight out like this and their legs, the Kimbo. And between them, these two stick figures

was a hula hoop sized circle. And that side of that circle was another like basketball size proportionally to the people. And he said, what is it? And my dad looked at it and he said, I don't know. And my brother said, it's two men walking abreast. And so, you know, it's got all of the markers there. It's got boobs and badly drawn figures and a pun.

So my dad starts laughing, and my brother is just filled with this, like, little boy glee. And you know how, like, when you're with love, your loved ones, and you start laughing, you can, like, feed off of each other. And my dad got laughing so hard he was crying. And all of a sudden he fell out of his chair onto the kitchen floor.

And he started to turn purple. And so my mom, who's a nurse, cleared the area and was about to perform CPR. And I ran over to the phone and had dialed nine. It was making ready to dial one, and he sat up. And he looked at all of us in confusion, and he said, why am I on the floor? And so my mom calmed everyone down.

And she said to him, she said, well, you need to go to the doctor because that's not OK for like a 40-year-old man to faint. And so the next day or two days later he went to his family practitioner and he told the doctor what had happened, and the doctor looked at my dad, and he said, well, what was the joke? And so my dad asked for a pad of paper. And he told the joke and the doctor looked at him

with incredulity. And so my dad starts laughing and remembering his laughter from the night before he gets laughing so hard that he got woozy. And so the doctor said, well, we need to run some tests, because that's not normal. And so they did some blood work. And everything came back normal.

And he called my father, who's a college professor. And he said, well, we think everything's OK. And so my dad, who was in his lab at the time, told his grad students the whole story. And he got to laughing so hard that he got losing and had to sit down. And so he called the doctor back and said, it happened again. And so the doctor said, well, let's run some more tests.

And an MRI or CT scan or something later, they're pretty sure nothing is wrong. But my dad is just laughing so hard, he's cutting off his airway. And so the doctor says, and just stopped telling the joke. My family were not allowed to tell that joke anymore. And if there could be a moral to the story, it's that, while laughter is the best medicine, sometimes too much of a good thing can kill you. That was Adrienne McGillis.

She says her dad still tells the story a lot and laughs too hard. I got a little nervous when I told her this story would be on air. I mean, what if her father listens and laughs and injures himself? But Adrian said, I'm sure he'll listen and I'll make sure he's sitting somewhere safe when he does. To see a photo of Adrian, her brother, and her dad laughing while whitewater rafting, go to the mall.org where you can also see the original drawing that accompanied this joke. And speaking of jokes, I asked my brother Cameron, who's the father of two great kids, about

his favorite dad jokes. What do you get when you mix a elephant and a rhinoceros? What? Elephino. It's healthy another one. What did the Atlantic Ocean say to the Pacific Ocean? Tell me. Nothing.

It just waived. What do you call a cheese all by itself? What? What? Provolone. I don't know if you think I get that. You're not a dad. I'm not a dad.

You saying if I was a dad, I would get it? There's a good chance. There's a good chance. There's a good chance. [♪ Music playing in at Amal's Story Slam in New Orleans where we partner with Public Radio Station WWNL. Here's CJ live at Amal. Some of the best memories in my life. All come from this period of time that I remember as The Bachelor days.

They went like this. I'm six years old and I'm cruising down the highway in the passenger seat and in the driver's seat is my best friend and bachelor buddy, my dad. And we're moving our lives from Boston to New York. And for the whole four hour drive, we're looking at each other. We have the tape deck turned up, and we're singing, oh baby, baby, it's a wild world.

Don't go, don't go, don't go, don't go. Hard to get by, just upon a smile girl. Go, go, go, go, go, go, go. We played that tape, T for the Taylor Man so much that summer that we actually broke the tape. That was a thing that would happen. And then there was our anthem against the wind. We were running against the wind.

We were young and strong and still running against the wind. Yeah, Bob Seager fans. That's it, that's my whole story. But that was our anthem. That was the soundtrack to the Bachelor of Years. And the place that we were moving on Long Island, our house wasn't ready. And because our house wasn't ready,

we spent our summer in this little cramped Brooklyn Heights apartment. And in that place, we lived like two, 22-year-olds would live. We had no cookware. We had like one pan and two mugs out of which we would drink instant soup, like as our meals. We had no furniture except for this inflatable bed

that we would share every night. And each night we'd have to blow it up, but we'd have to take turns to make sure no one passed out. We'd be like, you're doing, you're doing, you're doing, go, go. And the best part was we ate cereal whenever the hell we wanted. You want Captain Crunch for dinner, son? Done! Like that was our life. And like two bros moving into a new apartment would make a point of serving the town,

you know, their block for bars, we would cruise our entire neighborhood to draw a mental map of every toy store and comic bookstore in a 10 mile radius, because in there was something more valuable than women. Action figures. So, six-year-old me and my father would burst into these places like two robber barons, like, everybody freeze! Me and the boy, see, we're looking for the new Greenland connection figure. Yes, the white one. Yes, the one with the light up ring, handed over, put it in the bag, and we'll be on our

way. And then he put me on his back, and we'd be gone like that. And that's how I remember that summer. New action figure in hand, on my way to Captain Crunch Dinner, riding on the back of my father, the two of us. Now it was just the two of us because my mother had just died, just a couple weeks earlier. Diagnosed with lung cancer in December, she made it just far enough to see me turn six.

And then the summer began. And when I look back on that time, I'm struck by the dichotomy between what I remember as these golden, wonderful bachelor days and the actual harrowing truth of what was happening. There's just two guys, one of whom who had just lost his mother, and one of whom who had just lost his wife. It's like finding an old cassette tape that you made. And you love this thing, and you dust it off years later, and you realize that there's a B-side on there that you've never even listened to.

Against the wind, we were running against the wind. And I realized that our soundtrack was actually my dad's morning songs, or the songs that he used to make sure that he could keep going in the day. I think about, I must have thought, a thousand times about that summer on his back, but just now, as I'm getting older, am I starting to think about the story of the person who was doing the carrying at the time. I wonder if he was scared. I wonder how he knew what to do when everything started falling apart. I wonder where in our little apartment he would go to cry so I couldn't see him.

And I wonder how he was able to turn what should have been the most devastating period of my life into something I remember as my best days, just taking pieces of rubble and making a world for me right on the fly. So now that I'm a real bachelor, drinking far more mug soup than I cared to admit. I often wonder what kind of man will I become. Then I realize I already know. CJ Hunt is an actor, writer, and a host of the Malk Main Stage. He's also a producer for BET's show The Run Down with Robin Thede. Since telling his story, CJ moved to New York, and he's trying to find the old Brooklyn

Heights apartment he and his father lived in back then. He's still incredibly close with his dad, he says, in a strange reversal, his father is the one with the action figures these days, posed on his desk like soldiers. For photographic evidence of that, go to themof.org. If these stories make you think of your own, remember that you can pitch us by recording your story right on our site, or call 877-799-Mof.

That's 877-799-6684. The best pictures are developed for mall shows all around the world. Eric Winger and I live in Bethesda, Maryland. You, her finger-wagging wife, can stay here. With that, my not-quite-12-year-old daughter, Kayla, wheeled her way into the Sephora store on the local shopping mall with a friend. Kayla loved going to the mall, which had everything she adored all in one place. Best of all, here she found freedom from adult supervision that she so rarely experienced anywhere else. Since the age of seven, Kayla had been unable to walk or care for herself without assistance

to get the side effects of cancer radiation treatments. The mall was different, here Kayla could wander off with a friend and this gave her a watch for a lie. Sometime later, Kayla happily emerged with a shiny black Sephora shopping bag on her arm. We started to walk when Kayla abruptly thrust the bag into my arms and said, here, dad, this is for you. I peaked inside to find a good-sized crystal bottle,

filled with an expensive Versace Cologne. What is this for, I asked? Your birthday, Kayla replied. I looked again and noticed that the receipt accidentally was left in the bag, showing a cost of exceeding $75. This was way too much for her to spend on me. But you already got me a birthday gift I've protested. Yeah, but the surprise was spoiled, Kayla countered. It is true her original surprise was accidentally ruined when a box was opened before she intercepted the mail. So now she was doubling down on a second birthday gift, all told she had spent more than $100

in my birthday way too much. I tried again, Kayla, why don't we go back and look for a smaller bottle, maybe something less expensive. This is too much to spend on me. Kayla looked at me in the eye very intently and declared, this is my money, I will spend it how I want. She closed with a line that I will never forget for however long I live. Sometimes she said, you should just say thanks. I blinked, I

stared at her for a moment and then I sheepishly said thanks. We lost Kayla only about two months later when the cancer savagely returned. I keep that bottle on my counter and look at it every morning when I'm getting dressed. I used to put it on every day, but now more than five years later the bottle is nearly empty. On special occasions like tonight, I throw caution to the wind. I spray the ice blue cologne on happily and it feels like a kiss from her sweet little lips. Just like that bottle, life has a gift that we need to celebrate and be thankful for. Remember you can pitch us at 877-799-Moth or online at theMoth.org, where you can also

share these stories or others from the Moth Archive. After our break, a young woman tells her preacher father a secret that will make her unpopular with the church. when the Moth Radio Hour continues. The Moth Radio Hour is produced by Atlantic Public Media in Woods Hole, Massachusetts, and presented by PRX. The Moth is brought to you by Progressive, home of the Name Your Price tool. You say how much you want to pay for current insurance, and they'll show you coverage options that fit your budget. It's easy to start a quote. Visit progressive.com to get started.

Progressive casualty insurance company and affiliates. Price and coverage match limited by state law. This is the Moth Radio Hour from PRX. I'm Sarah Austin-Geness. This is an hour about fathers and our next storyteller comes from our global community program. Blessing Dia was part of a women and girls storytelling

workshop we held in Nairobi. She's a gender advocate who now fights for maternal health and women's rights, and that's a direct result of the events in this story. After the Nairobi workshop, I asked Blessing to join us in California and tell her story on the Moth main stage. So here's Blessing Dia, live at the Moth in Los Angeles. So here's Blessing Dia, live at the Moth in Los Angeles. Good evening. I'm the first child and daughter of a pastor.

I grew up as the only child for eight years. And I was very close to my dad. He used to call me his princess, his Cinderella. I used to get piggyback rides and use this afro to pretend I was a hairdresser. With that close. But you see, as a pastor, you get to share your time, your emotions, your resources, Kamiya, asapana, kamiwana I was a singing choir. I loved singing. I used to add dramas.

Take Bible quizzes. I was everywhere in church doing everything I could do. It seemed as if I was a mini pastor myself. In Nigeria, pastors and their families are not expected to do anything wrong. They are held to such high standards as the Dewey Seconds of God and then I get pregnant. And I'm married

teenage daughter of a pastor. Nihari, tihari, tihari, tihari, tihari, tihari, tihari, tihari, tihari,

tihari, tihari, tihari, aamorals, especially when it comes to sex. They found against premarital sex, and the applaud virginity. In fact, when you're getting married in your back communities, they give your husband a white handkerchief to put on there you during your first intercourse. He would let us show everyone that Hankachif,

to show that you are a virgin. And here I am, a 17-year-old teenage unmarried daughter of a pastor, breaking the code of the community and of the church. aptor, aptor, aptor, aptor, aptor, aptor,

aptor, aptor, aptor, aptor, aptor, aptor, aptor, aptor,

aptor, aptor, aptor, aptor, aptor, aptor, aptor, aptor, iutakatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatat The environment was dirty. I wish I could describe. And the equipment was very hideous. I went the first time. I ran away. And I think of my father again, and I come back.

But the environment is still dirty. In fact, I think it's more dirty this time. And the equipment are still hideous. So I get scared and I run away. And I feel what could go wrong. I'm not going to have this abortion in this dirty place. The worst that can go wrong is wrong to unopt my parents. So I decided to tell my father.

I know opportunity presents itself. Until one fit full morning, my father and my mother are having a discussion. I keep locking around corners. And my father calls out to me, bless it. She has something to say. I notice you locking around corners. For lack of better words to use, I blot, I'm pregnant. My mother is shocked.

You know how women are. We can be very dramatic. She is shocked. She is furious. My father sits there, silent, trying to take in what I just said. He asks me what I want to do with it. I explain ...at kagakatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatat My father. But you see, those consequences are not far off because I'm no longer active in church. I stop going to church. And people are beginning to talk. People are beginning to have their own suspicions. And in fact, at that period,

many people who come to my house for counseling just come on that the guys of counseling, but they really want to confirm if blessing is pregnant. Many of them go the extra mile and ask my dad, oh, how is blessing? Where is she? It's been long with so her. And then my dad has to call me out to say hello and they look at me closely to confirm if I'm pregnant. I feel ashamed. And most times, I feel pity for my dad

because people have judging him because of me. i'ot, ker, ker, ker, ker, ker, ker, ker, ker, ker,

ker, ker, ker, ker, ker, ker, during service, my dad walks up to the podium. And I'm in the congregation wondering what is he doing? Because you see, my dad never breaks protocol. And he wasn't built to speak that day. So I'm wondering what is he doing? And he walks up to the podium, one like this, but he removes the mic and he goes,

I'm not here to preach. I'm here to tell you that blessing is pregnant. And time freezes. Everyone goes silent. Nguyen Nant, dan tengen, semua gong silen, orang yang bergir, orang yang bergir, mereka bergir di atas, mereka bergir di atas,

mereka bergir di atas, mereka bergir di atas, mereka bergir di atas, mereka bergir di atas, Kutak. Kutak. Kutak. Kutak. Kutak. Kutak. Kutak. Kutak.

Kutak. Kutak. Kutak. Kutak. Kutak. Kutak. asa family in our privacy. Ysin, in that moment, my father was accepting that he was human and that his family may included a human too. Sinage pregnancy comes with a lot of stigma and discrimination.

But ysin, that act by my father went a long way apto kakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakakak As though he has not dropped a bombshell on everyone. I was seven months gone at the time. Two months later, I would welcome a beautiful baby girl into my life, who my father named Glory. And he was there. He was there for me. Ngai Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga Nga We became closer. That distance was not there anymore. He became my closest confidant. There's nothing I cannot talk to my father about. Because you see, my father, in that period,

he didn't think of his position, he didn't think of what the society thought. He didn't think of everything he had built. He thought of me. He thought of my future. He knew that I could become something greater. And it held my hand. At every step of the way, he still holds my hand.

My father let me realize that no matter what we go through in life, there will always be someone, or that group of people that will hold your hand, that will keep nodding you on. And that family will always, always be family. Thank you. Listen, dear, is a sexual and reproductive health advocate who works for women deliver in Africa and she says her father is proud of her. Nigerian tradition allows grandparents to name their grandkids, so blessings father named her first and second child.

She said, my father and I speak on the phone every day at least twice. He does the bulk of the calling. We talk, catch up, and pray together. But most times, when we see each other, I'm competing with my kids for his attention. My brother Cameron has two kids, Elliot, he's three, and Amelia, she's almost two. And I asked them to weigh in. What's special about your dad? He loves me What else is special? Trains

What does he do that super cool? Flips He does flips? Yeah, he flips you. Yeah Amelia, what do you think about your dad? Why do you love him so much? Of course And does he love you? Yeah Is it? Why do you love him so much? Good. And does he love you? Yeah.

Is it fun to hang out with him? Yeah. Okay, good. Okay, good. After the break, two short stories. One about choosing who you call dad. And one about a simple gesture and forgiveness when the Mothradio Hour continues.

The Mothradio Hour is produced by Atlantic Public Media in Woods Hole, Massachusetts, and presented by the Public Radio Exchange, PRX.org. You're listening to The Moth Radio Hour from PRX. I'm Sarah Austin-Geness. In this hour about fathers, I want to name the fact that some men are dads only through DNA. A father figure, or the man we call dad, may not in fact be blood-related. And while we're on the subject, some single moms are both moms and dads, and some people

have two moms, so shout out to the moms listening to. Our next storyteller is Lauren Thurman, and she told this at an open mic moth slam in Washington, DC, where we partner with Public Radio Station, W-A-M-U. Here's Lauren live at the mom. Applause. Whenever I fold towels, I think about skip. I have to fold them the right way, the only way. You fold them crosswise, and then again,

and then you fold that rectangle into very precise thirds. If you do it out of order, you're wrong. You're just wrong, sorry. It makes a clean edge. They stack very nicely, and these things are really important to any potential guests that you might have in the future. Before I met Skip, I did not fold my towels this way.

In fact, I folded them a different way, and I'm very sorry that I did that. And when he showed me his method, I think I actually said, that's stupid. I should do that. But that's how I do it now. And that's how I will do it until my dying day. Skip, by the way, is my dad.

He has not been my dad for very long. And I still can't bring myself to call him dad, not really because of the novelty of it, but because I actually went through a couple dads first, and the name like wears itself out after a while. So first there was Robert. Robert was the generous but accidental donor of my other ex-cromazone.

And he was not entirely absent. He would drop in on birthdays and stuff, which was great because I knew that I meant junk food and toys were coming. But he was always just a little too wrapped up in himself, too busy nurturing his depression and his genius and his confusion to really, really be a dad for me. And when I was eight, he sent me this long letter explaining to me what depression is and why it made him so hard for me, which by the way, it's way more responsibility

than an eight-year-old should have to shoulder. And I think I could recognize that. And I sort of said, you know, if he wants to be my dad, he can do that, but I'm not going to put any more into this. The man that my father married a couple years after I was born was Walter. He was my real dad, even though he wasn't my biological dad, which I loved explaining to my friends all through school.

It made me very interesting. And Walter, I would give him a solid B. He was a B dad. He was fun and loving. And he made OK pancakes, but he never really laid down the law. He was the parent you loved, but didn't respect very much. And so when my parents got divorced in high school, that is when I was in high school, he sort of disintegrated. He couldn't really pull himself together.

And he fell into this puddle of need and reached out to me to take care for him, which by the way way more responsibility than a 15-year-old should shoulder. And I recognized that, and so I moved away with my mom. And after a couple years, she fell in love with and moved in with Skip. Skip and I clicked right away, but we didn't really bond. We were very similar, but in all of the ways that are probably the less flattering parts of our personality.

He's very stubborn. He thinks he's right all the time. He uses ostentatiously large words to try and prove that he's right. You know, just like, ugh. And he did things like, tell me to fold his towels the right way, which I wasn't about, right? I was 16. I was going to do what I wanted. But the thing is, if you fold Skips towels the wrong way, he will tell you that you're wrong by dumping those towels out onto your bedroom floor so that you have to then wash, dry,

and fold them again. And this could be infuriating, right? And we're trying to get close to each other, my mother is trying to bring us closer together because this is a really important guide to her. But it doesn't really mesh, and I don't think we really bond until one fateful night when we get pizza together, and we watch how to train your dragon.

And this would become actually a really important movie to us. He, at the end of the movie, he turned to me, and he said, Lauren Lauren you're the dragon and I am I am this this little Viking trying to get close to you and this is Entirely on your terms and I'm just waiting for you To let you in to let me in and I cried and he cried and there was like lots of crying I'm sure my mom cried, but she had like gone to the other room. She just left us to it And so that's when we really opened up to each other. And when he first made clear to me that I was important to him,

that I was so much more than just this teenager who had invaded his home at such an otherwise peaceful time in his life. And he ended up telling me, Lauren, about 16 years ago, my first wife, and we lost a baby girl. And I've thought about her ever since, who she might be and how we might be together. And I always pictured somebody like you, somebody who is stubborn and forthright and very smart.

That was him that said that, not me. And I just lost it. And I thought, what a shame it is that the narrative of finding someone important to you is so often limited to romance narratives. It's Tom and Meg, it's Kate and Leo. But that's how Skip and I came together. He didn't raise me. I wasn't born to him. We had sort of been Looking for each other for our whole lives and then we found each other Two years after that night he adopted me officially But I think that night was the was the night that I really became his daughter. We've been figuring it out ever since. That was Lauren Thurman in Washington, D.C., where she works as a writer and an editor. Skip gave Lauren a shadow box last year that had pictures of the two of them, the first

Father's Day card she wrote to him, and a how to train your dragon poster. She says, it is perhaps the cheesiest thing he's ever done. And that's right, we have a photo of it just for you on our website, the law.org. Here's my father again, Thornton Janess. Do you like being a dad? Uh, there are times. Yes, I like being a dad.

Well, you take fatherhood very seriously, I think. That comes with the responsibility of having children. It's not just getting them through childhood, it's taking responsibility for them for the rest of their lives. Life changes as each decade goes on, your responsibility, and how you would evaluate what you've done in the form of being a father changes over the generation. So I'm looking back and seeing my children become parents and inspirational leaders in their own right, and I'm very proud of that.

I'm especially proud of being in their midst when they're with friends. And what about being a grandfather? It's fun. You babysit for them? Yes I do. Five AFDs a week. And they're running around upstairs right now? Yes they are. But that's Cameron and Kristen's responsibility. Not mine. That's why we're down in the basement. That's why we're down in the basement. Here's my brother Cameron.

What are some of the things you learned from dad about how to be a dad? Um, I mean, the memories I have of my dad are being down on the ground playing with us scooping around and letting us kind of explore and be ourselves, but being a part of that. I think that's really important to let their imagination go and kind of follow along with it and being a part of their life and trying to see what they see for the first time and trying to be able to explain it. I think that makes their growing up a little bit easier

when they know that they can ask good questions and be able to find an answer. That's kind of what dad said. He loved most about being a dad. That's pretty fun thing to do. Here's my father again. What do you think makes you a good dad? Or a good grandpa?

I think I'm approachable. What do you think makes you a good dad? Or a good grandpa? I think I'm approachable. I'm not so stern, but I think I'd like to put myself on the same level as my children. So literally you can see yourself squatting down and talking to the child. I'm not that short. As you're relating to them, but it's getting to the level where you can relate to them on their own terms and their own in their own language. Let me ask you why am I good-dead to you?

Um, yeah, I think you've always talked to me like we're friends. Yeah. But you talk to me like we're friends, but you talk to me like we're friends, but you have much more experience in the world. Thank you. I agree. You don't read a book on how to be a dad. You learn by scratching and clawing and making tough decisions.

Decisions you would sometimes regret and trying to learn a better way. would sometimes regret and trying to learn a better way. Relationships with our fathers can be a bit complicated, which brings us to our last storyteller. Harvard Taylor told us at one of our Grand Slam's in Texas, where we partner with Houston Public Media. Here's Harvard, live at the mall. Thank you. I always remember loving my father's hands.

In the mid 60s and the early 70s, I was probably about this high, and I would put my chin right where his typewriter was. And you have one of those old stacked key typewriters. Remember that, that sound was was ever present and it was like white noise in our childhood. And he was also a draftsman. He did these beautiful drawings with charcoal and he would use his fingers. They would turn black, pushing the material around a shade or contour a figure drawing. And I saw his fingers in wet clay. There was just a grace about his fingers and his hands

that I just always remember being fascinated by. He was also a bipolar. And if you don't know what that is, it's just basically a chemical imbalance that'll make you maybe very excitable and high sometimes and also very low sometimes. It can be very scary, frankly, for a young family. And it was for me and my sisters. And just to give you a full of picture,

I mean, that sort of feeling of uneasiness, I loved my dad and he was creative and he was brilliant and could be very entertaining, but just emotionally didn't feel safe. For the last probably 15 plus years of his life, my sisters didn't speak to him. On the other hand, decided after lots of therapy and men's work, and men's work is when you try to get closer

to your dad and try to heal wounds usually, and it enabled me to commit to have breakfast with him every Sunday. And I remember one Sunday, one of my sisters said, how can you do that? And I said, it's service work. And she laughed and I said, I'm not kidding. I mean, it really was that hard to have breakfast with him. It was just that I didn't feel safe. So anyway, that was when he was 70.

Well, when he was 82, he was diagnosed with Alzheimer's. I didn't know anything about it. It scared me and I called, you know, got online, did looked up everything I could learn about it. And I found Houston Alzheimer's Association great organization, by the way. And they had these classes, and they would put the patients, my dad included in one classroom, and they'd put me

and the other caregivers in the other classroom. And afterward, we'd come and have lunch and talk about things, and it was the kind of stuff you never want to have to talk about, period, on Earth. And yet, we got closer and my heart certainly opened a little bit knowing that one day he might look at me and not know who I was. So going to pick him up one Sunday and for our obligatory Sunday breakfast. And it's not obligatory anymore.

I want to be with my dad now because I know that you know time might be short. And we're driving along and I look down and his 82 year old hand, beautiful 82 year old hand is sitting there on the middle console. And I just had this nice thought, I want to hold my father's hand. And I'm driving and I came to a red light and I looked down and I couldn't do it. And I was so scared. And all these things were going through my head. You know, you did all this therapy, and you did these men's groups,

and you know, what is this? I can't hold my father's hand, my 82-year-old father's hand. What's wrong with me? And then I thought, you know, how many times did my dad hold my hand? A little hardwood's hand, you know, as a boy, as a child. You know, maybe my little hand in his hand, maybe every day, you know, thousands of times,

you know, what's wrong with me? Well luckily, or saved by the green light, you know, I started driving again, turning the silver in my head, and I come to the next red light. I look down and I see his hand again, and I just say, I want to hold my father's hand. I can't do it. You know, I thought, is he going to use that sharp wit and say something mean to me? Is he going to use that sharp wit and say something mean to me?

Is he going to pull his hand away? Would he hit me? Is he had hit me? So I remember I was here in Houston and I turned on the Heights Boulevard and there was a stop sign. And there wasn't anybody behind us. There happened to be a woman sitting on a bench. I don't know why we caught eyes. And when I took my hand off the steering wheel, you know, it was just a few inches to touch my father's hand, but it might as well have been my

foot leaving a thousand foot, unji jump. It was the scariest thing I did in my life. And when I touched his hand, immediately his other hand came over and covered my hand. And it was, it was like he'd them waiting for me to do that. And it felt, strangely, familiar, like we had been doing it forever. For the last two years of my father's life, whenever we went anywhere in a car. We held hands. That was Harvard Taylor. Harvard is vice president of a fine art gallery in Houston, and he loves telling stories. To see a photo of Harwood and his father,

on the way to a Houston Rockets basketball game when Harwood was 13, go to the moth.org. We've had all kinds of dads in this hour, and something I realized in talking to my dad and my brother is they love being fathers. They take the responsibility very seriously. Here's my dad and my brother one more time. If you could give new dads a piece of advice, what would it be? Be sensitive to everyone's needs around you.

Be willing to give a helping hand. Just your first and think later. Be proud of the moment because it will pass very quickly. Cammy, what's some advice that you'd give to new dads help out any way that you can and and just try and do as much for your family as as possible whether that's taking a feeding at night or throwing out really stinky diapers and garbage or whatever it is to kind of get your hands dirty and be a part of it because it happens way too fast.

So thank you to my brother and my dad and to the other dads and grand dads out there and the step dads, the father figures and the wannabe dads and thank you for listening. And that's it for this episode of The Moth Radio Hour. We hope you'll join us next time. Your host this hour with Sarah Austin Geness. Sarah also directed the stories in the show along with Jennifer Hickson. The rest of the most directorial staff includes Katherine Burns, Sarah Haberman and Meg Bulls, production support from Timothy Lulee and Lola Okusami. The Moth would like to thank the Bill and Melinda Gates Foundation for their support of the

Moth community program. Moth stories are true, as remembered and affirmed by the storytellers. Our theme music is by the Drift, other music in this hour, from Stelwagan's symphonet, Kormack, Bob Seeger, Regina Carter, Bill Freselle, and Duke Levine. And find links to all the music we use at our website. The Mothradio Hour is produced by me, Jay Allison, with Vicki Merrick,

at Atlantic Public Media, in Woods Hole, Massachusetts. This hour was produced with funds from the National Endowment for the Arts. The Mothradio Hour is presented by the Public Radio Exchange, prx.org. For more about our podcast for information on pitching your own story and everything else, go to our website, TheMoth.org. www.TheMoth.org you